Regulon of HrcA in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_1830
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.1 Sequence: TTAGCAGTCAGATACATAGAGTGCTAA Locus tag: SDEG_1830 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SDEG_1829 Name: grpE Funciton: Heat shock protein GrpE Locus tag: SDEG_1827 Name: dnaK Funciton: Chaperone protein DnaK
	SDEG_1830	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SDEG_1829	grpE	Heat shock protein GrpE
	SDEG_1827	dnaK	Chaperone protein DnaK
Position: -61 Score: 7.7 Sequence: TTAGCACTCGTACAACAAGAGTGCTAA Locus tag: SDEG_2041 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SDEG_2040 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SDEG_2041	groS	Heat shock protein 60 family co-chaperone GroES
	SDEG_2040	groL	Heat shock protein 60 family chaperone GroEL
Position: -141 Score: 6.1 Sequence: TTATCACTCTATCCCTGACAGTGCTAA Locus tag: SDEG_1496 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SDEG_1496	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD