Regulon of HrcA in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_0298
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -226 Score: 7.8 Sequence: TTAGCACTCTAAGCAAAAGAGTGCTAA Position: -140 Score: 7.4 Sequence: TTAGCACTCGATATCATAGAGTGCTAA Locus tag: SSU05_0298 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SSU05_0299 Name: grpE Funciton: Heat shock protein GrpE Locus tag: SSU05_0300 Name: dnaK Funciton: Chaperone protein DnaK
	SSU05_0298	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SSU05_0299	grpE	Heat shock protein GrpE
	SSU05_0300	dnaK	Chaperone protein DnaK
Position: -20 Score: 7.7 Sequence: TTAGCACTCGAATACAAAGAGTGCTAA Locus tag: SSU05_0147 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SSU05_0148 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL Locus tag: SSU05_0149 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SSU05_0147	groS	Heat shock protein 60 family co-chaperone GroES
	SSU05_0148	groL	Heat shock protein 60 family chaperone GroEL
	SSU05_0149	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD