Regulon of HrcA in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_0400
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 7.9 Sequence: TTAGCACTCTTGCAAAAAGAGTGCTAA Position: -59 Score: 6.3 Sequence: TTAGCACTCAAAGTGGTCGAGTGCTAA Locus tag: SGO_0400 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SGO_0401 Name: grpE Funciton: Heat shock protein GrpE
	SGO_0400	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SGO_0401	grpE	Heat shock protein GrpE
Position: -50 Score: 7.3 Sequence: TTAGCACTCGATAGACGAGAGTGCTAA Locus tag: SGO_1886 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SGO_1885 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SGO_1886	groS	Heat shock protein 60 family co-chaperone GroES
	SGO_1885	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD