Regulon of HrcA in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_2009
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 8 Sequence: TTAGCACTCTTGTAAAAAGAGTGCTAA Position: -59 Score: 7 Sequence: TTAGCACTCGAGGTGATTGAGTGCTAA Locus tag: SSA_2009 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SSA_2008 Name: grpE Funciton: Heat shock protein GrpE
	SSA_2009	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SSA_2008	grpE	Heat shock protein GrpE
Position: -51 Score: 7.3 Sequence: TTAGCACTCGATAGTTTAGAGTGCTAA Locus tag: SSA_0225 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SSA_0226 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SSA_0225	groS	Heat shock protein 60 family co-chaperone GroES
	SSA_0226	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD