Regulon of HrcA in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_0241
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 7.5 Sequence: TTAGCACTCGATGTATTAGAGTGCTAA Locus tag: GALLO_0124 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: GALLO_0125 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	GALLO_0124	groS	Heat shock protein 60 family co-chaperone GroES
	GALLO_0125	groL	Heat shock protein 60 family chaperone GroEL
Position: -144 Score: 7.1 Sequence: ATAGCACTCTTAGCATAAGAGTGCTAA Locus tag: GALLO_0612 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	GALLO_0612	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -130 Score: 8 Sequence: TTAGCACTCTACTAAAAAGAGTGCTAA Position: -47 Score: 7.1 Sequence: TTAGCAGTCGAGGTATATGAGTGCTAA Locus tag: GALLO_0241 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: GALLO_0242 Name: grpE Funciton: Heat shock protein GrpE Locus tag: GALLO_0243 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: GALLO_0245 Name: dnaJ Funciton: Chaperone protein DnaJ
	GALLO_0241	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	GALLO_0242	grpE	Heat shock protein GrpE
	GALLO_0243	dnaK	Chaperone protein DnaK
	GALLO_0245	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD