Regulon of HrcA in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str0118
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 8 Sequence: TTAGCACTCTTTCAAAAAGAGTGCTAA Position: -49 Score: 7.2 Sequence: TTAGCAGTCGTTGTACGAGAGTGCTAA Locus tag: str0118 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: str0119 Name: grpE Funciton: Heat shock protein GrpE Locus tag: str0120 Name: dnaK Funciton: Chaperone protein DnaK
	str0118	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	str0119	grpE	Heat shock protein GrpE
	str0120	dnaK	Chaperone protein DnaK
Position: -79 Score: 6.4 Sequence: TTAGCAGTTGTCTATCGTGAGTGCTAA Locus tag: str0203 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: str0204 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	str0203	groS	Heat shock protein 60 family co-chaperone GroES
	str0204	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD