Regulon of HrcA in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG0095
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 7.9 Sequence: TTAGCACTCTTTGAATAAGAGTGCTAA Position: -58 Score: 7.2 Sequence: TTAGCAGTCGATGTGTAAGAGTGCTAA Locus tag: SAG0095 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SAG0096 Name: grpE Funciton: Heat shock protein GrpE Locus tag: SAG0097 Name: dnaK Funciton: Chaperone protein DnaK
	SAG0095	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SAG0096	grpE	Heat shock protein GrpE
	SAG0097	dnaK	Chaperone protein DnaK
Position: -64 Score: 7.5 Sequence: TTAGCACTCTCTGTATAAGAGTGCTAA Locus tag: SAG2075 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SAG2074 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SAG2075	groS	Heat shock protein 60 family co-chaperone GroES
	SAG2074	groL	Heat shock protein 60 family chaperone GroEL
Position: -143 Score: 6.9 Sequence: TTAGCACTCTAATATATTCAGTGCTAA Locus tag: SAG0488 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SAG0488	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD