Regulon of HrcA in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_0515
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 7.8 Sequence: TTAGCACTCTTGATAAAAGAGTGCTAA Position: -53 Score: 6.5 Sequence: TTAGCACTTGGATGCATTGAGTGCTAA Locus tag: SP_0515 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SP_0516 Name: grpE Funciton: Heat shock protein GrpE
	SP_0515	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SP_0516	grpE	Heat shock protein GrpE
Position: -57 Score: 7.6 Sequence: TTAGCACTCAAGTTCAAAGAGTGCTAA Locus tag: SP_1907 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SP_1906 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SP_1907	groS	Heat shock protein 60 family co-chaperone GroES
	SP_1906	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD