Regulog RbsR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 3 | 3 |
| Lactobacillus casei ATCC 334 | 5 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 5 | 3 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 3 | 1 |
| Lactobacillus reuteri JCM 1112 | 2 | 1 |
| Lactobacillus rhamnosus GG | 2 | 1 |
| Lactobacillus sakei subsp. sakei 23K | 4 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 2 | 2 |
| Oenococcus oeni PSU-1 | 4 | 2 |
| Pediococcus pentosaceus ATCC 25745 | 3 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| rbsR |
|
Gene: LVIS_1422: Transcriptional repressor of ribose utilization, LacI family |
*
Lactobacillus casei ATCC 334 Site: position = -45 score = 6.73597 sequence = TAAGTAAAACGTTTTACCTA Gene: LSEI_0306: Transcriptional repressor of ribose utilization, LacI family |
|
*
Lactobacillus fermentum IFO 3956 Site: position = -44 score = 5.98689 sequence = TTAGTAAACTGTTTTATTAA Gene: LAF_1343: Transcriptional repressor of ribose utilization, LacI family |
|
|
Gene: lp_3661: Transcriptional repressor of ribose utilization, LacI family |
*
Lactobacillus reuteri JCM 1112 Site: position = -35 score = 4.66901 sequence = TAGATAAAACTGTTTACTAA Gene: LAR_1219: Transcriptional repressor of ribose utilization, LacI family |
*
Lactobacillus rhamnosus GG Site: position = -46 score = 6.73597 sequence = TAAGTAAAACGTTTTACCTA Gene: LGG_00372: Transcriptional repressor of ribose utilization, LacI family |
Gene: LSA0203: Transcriptional repressor of ribose utilization, LacI family |
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -123 score = 6.56921 sequence = TTAGTAAAACGTTTAACCAA Gene: LEUM_0795: Transcriptional repressor of ribose utilization, LacI family |
*
Oenococcus oeni PSU-1 Site: position = -47 score = 5.11961 sequence = TGTTGTAAACGTTTTAAGAA Gene: OEOE_0146: Transcriptional repressor of ribose utilization, LacI family |
Gene: PEPE_1700: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
| rbsD |
Gene: LBA1484: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Lactobacillus brevis ATCC 367 Site: position = -125 score = 5.03979 sequence = TAAGTAAATCGATTTACGCA Gene: LVIS_1589: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: LSEI_0307: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
Gene: LAF_1737: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
Gene: LJ1214: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: lp_3659: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: LAR_0400: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
Gene: LSA0201: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
Gene: OEOE_1613: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: PEPE_1698: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: LBA1483: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: LSEI_0308: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
|
|
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: LBA1482: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: LSEI_0309: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
|
|
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
Gene: LBA1481: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: LSEI_0310: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
|
|
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsU |
|
|
|
|
|
|
Gene: LJ1213: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
Gene: lp_3658: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
|
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -49 score = 6.91678 sequence = TTAGTAAAACGTTTTACTAA Gene: LSA0200: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
|
|
|
Gene: PEPE_1697: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
| rbsK |
2
Lactobacillus acidophilus NCFM Gene: LBA0587: Ribokinase (EC 2.7.1.15) Gene: LBA1485: Ribokinase (EC 2.7.1.15) |
*
Lactobacillus brevis ATCC 367 Site: position = -50 score = 6.46515 sequence = TACGTAAAACGTTTTACAAA Gene: LVIS_1421: Ribokinase (EC 2.7.1.15) |
Gene: LSEI_0312: Ribokinase (EC 2.7.1.15) |
Gene: LBUL_0470: Ribokinase (EC 2.7.1.15) |
*2
Lactobacillus fermentum IFO 3956 Site: position = -47 score = 5.00107 sequence = AACGTAAAACGATTTACTGA Gene: LAF_1689: Ribokinase (EC 2.7.1.15) Site: position = -59 score = 6.22954 sequence = TACGTAAAAGGTTTTAACAA Gene: LAF_1738: Ribokinase (EC 2.7.1.15) |
|
Gene: LJ0797: Ribokinase (EC 2.7.1.15) |
*
Lactobacillus plantarum WCFS1 Site: position = -74 score = 6.22293 sequence = TTATTAAAACGTTTTCATAA Site: position = -61 score = 6.05536 sequence = TTCATAAAACGTTTTAATAA Gene: lp_3660: Ribokinase (EC 2.7.1.15) |
2
Lactobacillus reuteri JCM 1112 Gene: LAR_1218: Ribokinase (EC 2.7.1.15) Gene: LAR_0399: Ribokinase (EC 2.7.1.15) |
Gene: LGG_00373: Ribokinase (EC 2.7.1.15) |
Gene: LSA0202: Ribokinase (EC 2.7.1.15) |
Gene: LSL_0423: Ribokinase (EC 2.7.1.15) |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -46 score = 6.56921 sequence = TTAGTAAAACGTTTAACCAA Gene: LEUM_0794: Ribokinase (EC 2.7.1.15) |
*
Oenococcus oeni PSU-1 Site: position = 25 score = 6.44693 sequence = TTAGTAAAGCGTTTTACTTA Gene: OEOE_1612: Ribokinase (EC 2.7.1.15) |
*
Pediococcus pentosaceus ATCC 25745 Site: position = -67 score = 5.64475 sequence = CTATTAAAACGTTTTCATAA Site: position = -54 score = 5.33283 sequence = TTCATAAAACGTTTTAAACA Gene: PEPE_1699: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsP |
|
*
Lactobacillus brevis ATCC 367 Site: position = -48 score = 5.21207 sequence = GATGTAAAACGTTTTACGAT Gene: LVIS_1588: Predicted ribose permease |
|
|
Gene: LAF_1736: Predicted ribose permease |
|
|
Gene: lp_0498: Predicted ribose permease |
Gene: LAR_0401: Predicted ribose permease |
|
|
|
|
Gene: OEOE_1614: Predicted ribose permease |
|
Predicted ribose permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |