Regulon of RbsR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA0203
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.9 Sequence: TTAGTAAAACGTTTTACTAA Locus tag: LSA0200 Name: rbsU Funciton: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) Locus tag: LSA0201 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: LSA0202 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: LSA0203 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	LSA0200	rbsU	Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
	LSA0201	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	LSA0202	rbsK	Ribokinase (EC 2.7.1.15)
	LSA0203	rbsR	Transcriptional repressor of ribose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD