Regulon of RbsR in Lactobacillus fermentum IFO 3956

Properties
Regulator type:	Transcription factor
TF locus tag:	LAF_1343
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.2 Sequence: TACGTAAAAGGTTTTAACAA Locus tag: LAF_1738 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: LAF_1737 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: LAF_1736 Name: rbsP Funciton: Predicted ribose permease
	LAF_1738	rbsK	Ribokinase (EC 2.7.1.15)
	LAF_1737	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	LAF_1736	rbsP	Predicted ribose permease
Position: -44 Score: 6 Sequence: TTAGTAAACTGTTTTATTAA Locus tag: LAF_1343 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	LAF_1343	rbsR	Transcriptional repressor of ribose utilization, LacI family
Position: -47 Score: 5 Sequence: AACGTAAAACGATTTACTGA Locus tag: LAF_1689 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	LAF_1689	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD