Regulon of RbsR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_1700
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.6 Sequence: CTATTAAAACGTTTTCATAA Position: -54 Score: 5.3 Sequence: TTCATAAAACGTTTTAAACA Locus tag: PEPE_1699 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: PEPE_1698 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: PEPE_1697 Name: rbsU Funciton: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
	PEPE_1699	rbsK	Ribokinase (EC 2.7.1.15)
	PEPE_1698	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	PEPE_1697	rbsU	Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD