Regulon of RbsR in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_1422
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 5.2 Sequence: GATGTAAAACGTTTTACGAT Locus tag: LVIS_1588 Name: rbsP Funciton: Predicted ribose permease
	LVIS_1588	rbsP	Predicted ribose permease
Position: -125 Score: 5 Sequence: TAAGTAAATCGATTTACGCA Locus tag: LVIS_1589 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	LVIS_1589	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Position: -50 Score: 6.5 Sequence: TACGTAAAACGTTTTACAAA Locus tag: LVIS_1421 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	LVIS_1421	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD