Regulon of RbsR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_0795
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 6.6 Sequence: TTAGTAAAACGTTTAACCAA Locus tag: LEUM_0795 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	LEUM_0795	rbsR	Transcriptional repressor of ribose utilization, LacI family
Position: -46 Score: 6.6 Sequence: TTAGTAAAACGTTTAACCAA Locus tag: LEUM_0794 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	LEUM_0794	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD