Regulon of RbsR in Oenococcus oeni PSU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	OEOE_0146
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.1 Sequence: TGTTGTAAACGTTTTAAGAA Locus tag: OEOE_0146 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	OEOE_0146	rbsR	Transcriptional repressor of ribose utilization, LacI family
Position: 25 Score: 6.4 Sequence: TTAGTAAAGCGTTTTACTTA Locus tag: OEOE_1612 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: OEOE_1613 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: OEOE_1614 Name: rbsP Funciton: Predicted ribose permease
	OEOE_1612	rbsK	Ribokinase (EC 2.7.1.15)
	OEOE_1613	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	OEOE_1614	rbsP	Predicted ribose permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD