Regulon of RbsR in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_1219
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 4.7 Sequence: TAGATAAAACTGTTTACTAA Locus tag: LAR_1219 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: LAR_1218 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	LAR_1219	rbsR	Transcriptional repressor of ribose utilization, LacI family
	LAR_1218	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD