Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of RbsR in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_0306
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 6.7
Sequence: TAAGTAAAACGTTTTACCTA
Locus tag: LSEI_0306
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: LSEI_0307
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: LSEI_0308
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: LSEI_0309
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: LSEI_0310
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR
Transcriptional repressor of ribose utilization, LacI family
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD