Regulon of RbsR in Lactobacillus casei ATCC 334
Regulator type: | Transcription factor |
TF locus tag: | LSEI_0306 |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Ribose utilization |
Effector: | Ribose |
Regulog: | RbsR - Lactobacillaceae |
Statistics of regulated genes: | |
- Genes | 5 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
Locus Tag | Name | Function | |
---|---|---|---|
Position: -45
Score: 6.7 Sequence: TAAGTAAAACGTTTTACCTA
Locus tag: LSEI_0306
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: LSEI_0307
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: LSEI_0308
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: LSEI_0309
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: LSEI_0310
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|||
rbsR
|
Transcriptional repressor of ribose utilization, LacI family
|
||
rbsD
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
|
||
rbsA
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
|
||
rbsC
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
|
||
rbsB
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |