Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbsC gene

Properties
Regulog: RbsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 18 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus casei ATCC 334
Position: -45
Score: 6.73597
Sequence: TAAGTAAAACGTTTTACCTA
Locus tag: LSEI_0306
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: LSEI_0307
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: LSEI_0308
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: LSEI_0309
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: LSEI_0310
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR-rbsD-rbsA-rbsC-rbsB -45 6.7 TAAGTAAAACGTTTTACCTA LSEI_0306