Regulog KdgR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - KdgR
- By taxonomy - Vibrionales
- By TF family - IclR
- By effector - 2-keto-3-deoxygluconate
- By pathway - Pectin and polygalacturonate utlization
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio vulnificus CMCP6 | 14 | 7 |
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | 12 | 6 |
| Vibrio shilonii AK1 | 12 | 4 |
| Vibrio splendidus LGP32 | ||
| Vibrio fischeri ES114 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio angustum S14 | ||
| Photobacterium profundum SS9 | 15 | 6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| togX1 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -93 score = 5.48939 sequence = AAATGAACCGTTGTTTTGATT Site: position = -29 score = 5.13607 sequence = AATTAAAACAGCGTTTCGAGG Gene: VPA0087: predicted oligogalacturonate transporter |
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -149 score = 5.52979 sequence = AAATGAACCGTTGTTTCGATT Site: position = -85 score = 5.31033 sequence = AATTAAAACGGCGTTTCGAGG Gene: PBPRB1723: predicted oligogalacturonate transporter |
predicted oligogalacturonate transporter |
| ogl |
|
|
|
Gene: VPA0088: Oligogalacturonate lyase (EC 4.2.2.6) |
|
|
|
|
|
Gene: PBPRB1722: Oligogalacturonate lyase (EC 4.2.2.6) |
Oligogalacturonate lyase (EC 4.2.2.6) |
| CRON 2. | |||||||||||
| VSAK1_20364 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -189 score = 5.79489 sequence = TATTAAAACGCCGTTTTAATA Gene: VSAK1_20364: Heparinase II/III-like protein |
Gene: VS_1246: Heparinase II/III-like protein |
|
|
|
|
Heparinase II/III-like protein |
| VSAK1_20369 |
|
|
|
|
Gene: VSAK1_20369: Heparinase II/III-like protein |
Gene: VS_1247: Heparinase II/III-like protein |
|
|
|
|
Heparinase II/III-like protein |
| togX2 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -130 score = 5.19003 sequence = TTTTGAAACACCATTTTATTT Site: position = -40 score = 5.22216 sequence = CTTTAAAACGGTGTTTTAATT Gene: VPA0084: predicted oligogalacturonate transporter |
Gene: VSAK1_20374: predicted oligogalacturonate transporter |
|
|
|
|
|
predicted oligogalacturonate transporter |
| CRON 3. | |||||||||||
| kdgM |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -110 score = 5.44752 sequence = AATTAAAACACCGTTTTAAAG Site: position = -20 score = 5.53499 sequence = AAATAAAATGGTGTTTCAAAA Gene: VPA0085: Oligogalacturonate-specific porin protein KdgM |
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -122 score = 5.56897 sequence = AATTAAAACGCCGTTTCAATG Site: position = -32 score = 5.8477 sequence = AATTAAAACGGCGTTTTAAAA Gene: PBPRB1726: Oligogalacturonate-specific porin protein KdgM |
Oligogalacturonate-specific porin protein KdgM |
| pelX |
|
|
|
Gene: VPA0086: Exopolygalacturonate lyase (EC 4.2.2.9) |
|
|
|
|
|
Gene: PBPRB1725: Exopolygalacturonate lyase (EC 4.2.2.9) |
Exopolygalacturonate lyase (EC 4.2.2.9) |
| CRON 4. | |||||||||||
| kduI |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -164 score = 5.4894 sequence = TTTTAAAACGCAGTTTCAAAA Gene: VSAK1_02644: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -124 score = 5.3854 sequence = TTTTGAAACGATGTATCAATA Gene: PBPRB1731: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
| oglP |
|
|
|
|
Gene: VSAK1_02649: predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
|
|
|
|
Gene: PBPRB1730: predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
| oglQ |
|
|
|
|
Gene: VSAK1_02654: predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
|
|
|
|
Gene: PBPRB1729: predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
| oglM |
|
|
|
|
Gene: VSAK1_02659: predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
|
|
|
|
Gene: PBPRB1728: predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
| kdgR2 |
|
|
|
|
Gene: VSAK1_02664: Transcriptional regulator, IclR family |
|
|
|
|
Gene: PBPRB1727: Transcriptional regulator, IclR family |
Transcriptional regulator, IclR family |
| CRON 5. | |||||||||||
| VV21107 |
|
*
Vibrio vulnificus CMCP6 Site: position = -114 score = 5.81008 sequence = TATTGAAATGATGTTTCAAAA Site: position = -67 score = 5.48069 sequence = AAATAAAAAGATGTTTTAAAA Gene: VV21107: Arylsulfatase regulator |
|
|
|
|
|
|
|
|
Arylsulfatase regulator |
| CRON 6. | |||||||||||
| VV21108 |
|
*
Vibrio vulnificus CMCP6 Site: position = -115 score = 5.3116 sequence = TTTTAAAACATCTTTTTATTT Site: position = -68 score = 5.64514 sequence = TTTTGAAACATCATTTCAATA Gene: VV21108: Putative sulfatase (EC 3.1.6.-) |
|
|
|
|
|
|
|
|
Putative sulfatase (EC 3.1.6.-) |
| VV21109 |
|
Gene: VV21109: Arylsulfatase (EC 3.1.6.1) |
|
|
|
|
|
|
|
|
Arylsulfatase (EC 3.1.6.1) |
| CRON 7. | |||||||||||
| ugl |
|
*
Vibrio vulnificus CMCP6 Site: position = -127 score = 5.50465 sequence = AATTGAAAAGGTGTTTTGAAA Gene: VV21092: Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain |
|
|
|
|
|
|
|
|
Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain |
| VV21091 |
|
Gene: VV21091: Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase |
|
|
|
|
|
|
|
|
Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase |
| cslA |
|
Gene: VV21090: Chondroitinase AC precursor (EC 4.2.2.5) |
|
|
|
|
|
|
|
|
Chondroitinase AC precursor (EC 4.2.2.5) |
| CRON 8. | |||||||||||
| VV21106 |
|
*
Vibrio vulnificus CMCP6 Site: position = -162 score = 5.47539 sequence = TATTGAAACGCTTTTTTATAT Site: position = -56 score = 5.17252 sequence = AATTGAACCATCATTTCATTT Gene: VV21106: Arylsulfatase A |
|
|
|
|
|
|
|
|
Arylsulfatase A |
| CRON 9. | |||||||||||
| kduD |
|
*
Vibrio vulnificus CMCP6 Site: position = -189 score = 5.23125 sequence = TTTTAAAATACCTTTTCATAA Site: position = -115 score = 6.0113 sequence = TTTTGAAACGTCTTTTCAAAA Gene: VV20914: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -194 score = 5.62217 sequence = TTTTAAAATGCCTTTTCAAAA Site: position = -121 score = 5.82453 sequence = TTTTAAAACGCCTTTTCAAAA Gene: VPA0077: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
*
Vibrio shilonii AK1 Site: position = -195 score = 4.77501 sequence = TTTCAAAAAGGCTTTTCATAA Site: position = -119 score = 5.61664 sequence = AAATGAAACGGCATTTCAAAA Gene: VSAK1_20309: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -194 score = 5.56589 sequence = TTTTAAAAAGCCTTTTCAAAA Site: position = -121 score = 5.79029 sequence = TTTTAAAACGTTATTTCAAAA Gene: PBPRB1737: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
| ygjV |
|
Gene: VV20913: Permease of the major facilitator superfamily |
|
Gene: VPA0078: Permease of the major facilitator superfamily |
Gene: VSAK1_20314: Permease of the major facilitator superfamily |
|
|
|
|
Gene: PBPRB1736: Permease of the major facilitator superfamily |
Permease of the major facilitator superfamily |
| kdgF |
|
Gene: VV20912: Putative pectin degradation protein |
|
Gene: VPA0079: Putative pectin degradation protein |
Gene: VSAK1_20419: Putative pectin degradation protein |
Gene: VS_1244: Putative pectin degradation protein |
|
|
|
Gene: PBPRB1735: Putative pectin degradation protein |
Putative pectin degradation protein |
| spiX |
|
Gene: VV20911: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
|
Gene: VPA0080: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
Gene: VSAK1_20319: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
|
|
|
|
Gene: PBPRB1734: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
| kdgK |
|
*
Vibrio vulnificus CMCP6 Site: position = -81 score = 5.73786 sequence = AATTGAACCATTGTTTTAAAA Gene: VV20905: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -82 score = 5.39868 sequence = AAATGAACCGTTGTTTTATTT Gene: VPA0082: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
Gene: VSAK1_20349: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
Gene: VS_1243: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
|
|
|
*
Photobacterium profundum SS9 Site: position = -81 score = 5.41705 sequence = TTATGAACCGATGTTTTATTT Gene: PBPRB1733: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
| eda |
|
Gene: VV20904: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
|
Gene: VPA0083: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: VSAK1_20344: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: VS_1242: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
|
|
|
Gene: PBPRB1732: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
| CRON 10. | |||||||||||
| kdgR |
|
*
Vibrio vulnificus CMCP6 Site: position = -234 score = 4.89379 sequence = AAGTGAACCGACGTTTTGGTT Site: position = -158 score = 5.8346 sequence = TTTTGAAAAGACGTTTCAAAA Site: position = -84 score = 5.358 sequence = TTATGAAAAGGTATTTTAAAA Gene: VV20915: 2-keto-3-deoxygluconate regulator KdgR |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -140 score = 5.7518 sequence = TTTTGAAAAGGCGTTTTAAAA Site: position = -67 score = 5.50876 sequence = TTTTGAAAAGGCATTTTAAAA Gene: VPA0076: 2-keto-3-deoxygluconate regulator KdgR |
*
Vibrio shilonii AK1 Site: position = -161 score = 5.44539 sequence = TTTTGAAATGCCGTTTCATTT Site: position = -85 score = 5.37113 sequence = TTATGAAAAGCCTTTTTGAAA Gene: VSAK1_20304: 2-keto-3-deoxygluconate regulator KdgR |
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -158 score = 5.67621 sequence = TTTTGAAATAACGTTTTAAAA Site: position = -85 score = 5.60743 sequence = TTTTGAAAAGGCTTTTTAAAA Gene: PBPRB1738: 2-keto-3-deoxygluconate regulator KdgR |
2-keto-3-deoxygluconate regulator KdgR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |