Regulon of KdgR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_20304
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Regulog:	KdgR - Vibrionales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By trascription factor - KdgR
By taxonomy - Vibrionales
By TF family - IclR
By effector - 2-keto-3-deoxygluconate
By pathway - Pectin and polygalacturonate utlization

Regulated operons
	Locus Tag	Name	Function
Position: -195 Score: 4.8 Sequence: TTTCAAAAAGGCTTTTCATAA Position: -119 Score: 5.6 Sequence: AAATGAAACGGCATTTCAAAA Locus tag: VSAK1_20309 Name: kduD Funciton: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) Locus tag: VSAK1_20314 Name: ygjV Funciton: Permease of the major facilitator superfamily Locus tag: VSAK1_20319 Name: spiX Funciton: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
	VSAK1_20309	kduD	2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
	VSAK1_20314	ygjV	Permease of the major facilitator superfamily
	VSAK1_20319	spiX	predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Position: -161 Score: 5.4 Sequence: TTTTGAAATGCCGTTTCATTT Position: -85 Score: 5.4 Sequence: TTATGAAAAGCCTTTTTGAAA Locus tag: VSAK1_20304 Name: kdgR Funciton: 2-keto-3-deoxygluconate regulator KdgR
	VSAK1_20304	kdgR	2-keto-3-deoxygluconate regulator KdgR
Position: -164 Score: 5.5 Sequence: TTTTAAAACGCAGTTTCAAAA Locus tag: VSAK1_02644 Name: kduI Funciton: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) Locus tag: VSAK1_02649 Name: oglP Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit Locus tag: VSAK1_02654 Name: oglQ Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit Locus tag: VSAK1_02659 Name: oglM Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit Locus tag: VSAK1_02664 Name: kdgR2 Funciton: Transcriptional regulator, IclR family
	VSAK1_02644	kduI	4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
	VSAK1_02649	oglP	predicted oligogalacturonate TRAP transporter, substrate-binding subunit
	VSAK1_02654	oglQ	predicted oligogalacturonate TRAP transporter, small transmembrane subunit
	VSAK1_02659	oglM	predicted oligogalacturonate TRAP transporter, large transmembrane subunit
	VSAK1_02664	kdgR2	Transcriptional regulator, IclR family
Position: -189 Score: 5.8 Sequence: TATTAAAACGCCGTTTTAATA Locus tag: VSAK1_20364 Name: VSAK1_20364 Funciton: Heparinase II/III-like protein Locus tag: VSAK1_20369 Name: VSAK1_20369 Funciton: Heparinase II/III-like protein Locus tag: VSAK1_20374 Name: togX2 Funciton: predicted oligogalacturonate transporter
	VSAK1_20364	VSAK1_20364	Heparinase II/III-like protein
	VSAK1_20369	VSAK1_20369	Heparinase II/III-like protein
	VSAK1_20374	togX2	predicted oligogalacturonate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD