Regulog IscR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | 11 | 3 |
| Thauera sp. MZ1T | 10 | 2 |
| Dechloromonas aromatica RCB | 10 | 2 |
| Nitrosomonas europaea ATCC 19718 | 8 | 1 |
| Nitrosospira multiformis ATCC 25196 | 10 | 2 |
| Thiobacillus denitrificans | 10 | 3 |
| Chromobacterium violaceum ATCC 12472 | 9 | 1 |
| Neisseria meningitidis MC58 | 2 | 1 |
| Laribacter hongkongensis HLHK9 | 9 | 1 |
| Methylobacillus flagellatus KT | 9 | 2 |
| Methylotenera mobilis JLW8 | 3 | 1 |
| Methylophilales bacterium HTCC2181 | 9 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| cysE |
*
Azoarcus sp. EbN1 Site: position = -62 score = 5.82695 sequence = AAACCCGACTAAACTAGTCGGGAAT Gene: ebA6405: Serine acetyltransferase (EC 2.3.1.30) |
*
Thauera sp. MZ1T Site: position = -95 score = 6.14886 sequence = ATAGTCGATTAAAATTCTCGGGAAT Gene: Tmz1t_2208: Serine acetyltransferase (EC 2.3.1.30) |
*
Dechloromonas aromatica RCB Site: position = -64 score = 6.14278 sequence = ATAGCTGACAAATTCAGTCGAGTAT Gene: Daro_1947: Serine acetyltransferase (EC 2.3.1.30) |
|
|
*
Thiobacillus denitrificans Site: position = -39 score = 6.53626 sequence = ATAGTTGACTAAAATACTCGGAAAT Gene: Tbd_1162: Serine acetyltransferase (EC 2.3.1.30) |
|
|
|
*
Methylobacillus flagellatus KT Site: position = -21 score = 4.55075 sequence = ATTTCAGAGTAAAATAGTCGGATGT Gene: Mfla_0811: Serine acetyltransferase (EC 2.3.1.30) |
Gene: Mmol_1670: Serine acetyltransferase (EC 2.3.1.30) |
*
Methylophilales bacterium HTCC2181 Site: position = -84 score = 5.96804 sequence = ATACTTGAGTTATTTACTCAGGATT Gene: MB2181_02935: Serine acetyltransferase (EC 2.3.1.30) |
Serine acetyltransferase (EC 2.3.1.30) |
| CRON 2. | |||||||||||||
| ydhD |
*
Azoarcus sp. EbN1 Site: position = -39 score = 5.24922 sequence = TTACCCGACTGAAACACTCAACTTT Gene: ebA1175: Probable monothiol glutaredoxin ydhD |
|
|
Gene: NE1911: Probable monothiol glutaredoxin ydhD |
Gene: Nmul_A2639: Probable monothiol glutaredoxin ydhD |
*
Thiobacillus denitrificans Site: position = -38 score = 5.10973 sequence = ATTCCCGAGTATTCCACTCAGGTAT Gene: Tbd_2499: Probable monothiol glutaredoxin ydhD |
|
|
|
|
|
|
Probable monothiol glutaredoxin ydhD |
| CRON 3. | |||||||||||||
| iscR |
*
Azoarcus sp. EbN1 Site: position = -91 score = 5.56115 sequence = GTAGTTGACCGATTTTGTCGGGTTA Site: position = -63 score = 5.84801 sequence = ATAGTCGAGTGAAACGTTCGGGTAT Gene: ebA6404: Iron-sulfur cluster regulator IscR |
*
Thauera sp. MZ1T Site: position = -75 score = 5.58039 sequence = ATACTCGACAAAAATGATGGGATAT Site: position = -103 score = 5.12715 sequence = TTAGTTGACCGTTTTTGTCGGGATC Gene: Tmz1t_2207: Iron-sulfur cluster regulator IscR |
*
Dechloromonas aromatica RCB Site: position = -69 score = 6.25007 sequence = ATAGTTGACTAATTTTCTCTGGTTT Site: position = -40 score = 5.46512 sequence = ATAGTTGACCTTAATACTAGGTTAT Site: position = -82 score = 5.1747 sequence = ATACCTGAGCAAAATAGTTGACTAA Gene: Daro_1948: Iron-sulfur cluster regulator IscR |
*
Nitrosomonas europaea ATCC 19718 Site: position = -100 score = 6.71766 sequence = ATAGTTGACTAATATTGTCGGGTAT Gene: NE1452: Iron-sulfur cluster regulator IscR |
*2
Nitrosospira multiformis ATCC 25196 Site: position = -225 score = 5.84844 sequence = ATACTTGATCAATGTTGTCGGGTAT Gene: Nmul_A0674: Iron-sulfur cluster regulator IscR Site: position = -103 score = 6.12231 sequence = ATAGTTGACTAAATCAGTCATCTAT Site: position = -131 score = 6.48735 sequence = ATAGTTGACTAAATCAATCAGGTAT Gene: Nmul_A0694: Iron-sulfur cluster regulator IscR |
*
Thiobacillus denitrificans Site: position = -88 score = 6.17141 sequence = ATAGTTGACTAAATTGCTAAGGTAA Site: position = -60 score = 6.48102 sequence = ATAGTTGACTGAAATGCTCGGGAAT Gene: Tbd_1163: Iron-sulfur cluster regulator IscR |
*
Chromobacterium violaceum ATCC 12472 Site: position = -71 score = 6.60071 sequence = ATACTTGACTAATTTAGTCGGATAT Gene: CV1095: Iron-sulfur cluster regulator IscR |
*
Neisseria meningitidis MC58 Site: position = -74 score = 6.26978 sequence = ATACTTGACTGAAACACTCAGATAT Gene: NMB1378: Iron-sulfur cluster regulator IscR |
*
Laribacter hongkongensis HLHK9 Site: position = -63 score = 6.39685 sequence = ATGGTTGACTAAATTAGTCGGGTTT Gene: LHK_02866: Iron-sulfur cluster regulator IscR |
*
Methylobacillus flagellatus KT Site: position = -111 score = 6.32029 sequence = ATAGTTGACTAAAGTATTCAGGTAT Gene: Mfla_0810: Iron-sulfur cluster regulator IscR |
*
Methylotenera mobilis JLW8 Site: position = -70 score = 6.33884 sequence = ATAGTTGACTAAAATTGTAAGGAAT Gene: Mmol_1671: Iron-sulfur cluster regulator IscR |
*
Methylophilales bacterium HTCC2181 Site: position = -58 score = 5.64876 sequence = ATACTTGATAGTTTTAGTCAAGTAT Gene: MB2181_02930: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS1 |
Gene: ebA6402: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Tmz1t_2206: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Daro_1949: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
|
Gene: Nmul_A0675: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
|
|
|
|
Gene: Mfla_0809: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Mmol_1672: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MB2181_02925: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscS2 |
Gene: ebA6401: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Tmz1t_2205: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Daro_1950: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
|
|
Gene: Tbd_1164: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: CV1094: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: NMB1379: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: LHK_02865: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Mfla_0808: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Mmol_1673: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MB2181_02920: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: ebA6400: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Tmz1t_2204: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Daro_1951: Iron-sulfur cluster assembly scaffold protein IscU |
|
|
Gene: Tbd_1165: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: CV1093: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: NMB1380: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: LHK_02864: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Mfla_0807: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Mmol_1674: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: MB2181_02915: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: ebB230: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Tmz1t_2203: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Daro_1952: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: NE1451: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Nmul_A0695: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Tbd_1166: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: CV1092: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: NMB1381: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: LHK_02863: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Mfla_0806: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Mmol_1675: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: MB2181_02910: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: ebA6397: Chaperone protein HscB |
Gene: Tmz1t_2202: Chaperone protein HscB |
Gene: Daro_1953: Chaperone protein HscB |
|
|
Gene: Tbd_1167: Chaperone protein HscB |
Gene: CV1091: Chaperone protein HscB |
Gene: NMB1383: Chaperone protein HscB |
Gene: LHK_02862: Chaperone protein HscB |
Gene: Mfla_0805: Chaperone protein HscB |
Gene: Mmol_1676: Chaperone protein HscB |
Gene: MB2181_02905: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: ebA6396: Chaperone protein HscA |
Gene: Tmz1t_2201: Chaperone protein HscA |
Gene: Daro_1954: Chaperone protein HscA |
|
|
Gene: Tbd_1168: Chaperone protein HscA |
Gene: CV1089: Chaperone protein HscA |
2
Neisseria meningitidis MC58 Gene: NMB1131: Chaperone protein HscA Gene: NMB1169: Chaperone protein HscA |
Gene: LHK_02861: Chaperone protein HscA |
Gene: Mfla_0804: Chaperone protein HscA |
Gene: Mmol_1677: Chaperone protein HscA |
Gene: MB2181_02900: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: ebB229: ferredoxin, 2Fe-2S type, ISC system |
Gene: Tmz1t_2200: ferredoxin, 2Fe-2S type, ISC system |
Gene: Daro_1955: ferredoxin, 2Fe-2S type, ISC system |
|
|
Gene: Tbd_1169: ferredoxin, 2Fe-2S type, ISC system |
Gene: CV1088: ferredoxin, 2Fe-2S type, ISC system |
|
Gene: LHK_02860: ferredoxin, 2Fe-2S type, ISC system |
Gene: Mfla_0803: ferredoxin, 2Fe-2S type, ISC system |
Gene: Mmol_1678: ferredoxin, 2Fe-2S type, ISC system |
Gene: MB2181_02895: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: ebA6395: putative Fe-S cluster assembly protein |
Gene: Tmz1t_2199: putative Fe-S cluster assembly protein |
Gene: Daro_1956: putative Fe-S cluster assembly protein |
|
|
Gene: Tbd_1170: putative Fe-S cluster assembly protein |
Gene: CV1087: putative Fe-S cluster assembly protein |
|
Gene: LHK_02858: putative Fe-S cluster assembly protein |
|
Gene: Mmol_1560: putative Fe-S cluster assembly protein |
Gene: MB2181_05240: putative Fe-S cluster assembly protein |
putative Fe-S cluster assembly protein |
| CV1911 |
|
|
|
|
|
|
|
|
Gene: LHK_02859: YbaK/prolyl-tRNA synthetase associated region |
|
|
|
YbaK family protein |
| CV1090 |
|
|
|
|
|
|
Gene: CV1090: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| sufB |
|
Gene: Tmz1t_1899: Iron-sulfur cluster assembly protein SufB |
|
Gene: NE1450: Iron-sulfur cluster assembly protein SufB |
Gene: Nmul_A0696: Iron-sulfur cluster assembly protein SufB |
|
|
|
|
|
Gene: Mmol_1129: Iron-sulfur cluster assembly protein SufB |
|
Iron-sulfur cluster assembly protein SufB |
| sufC |
|
Gene: Tmz1t_1898: Iron-sulfur cluster assembly ATPase protein SufC |
|
Gene: NE1449: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Nmul_A0697: Iron-sulfur cluster assembly ATPase protein SufC |
|
|
|
|
|
Gene: Mmol_1128: Iron-sulfur cluster assembly ATPase protein SufC |
|
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
|
Gene: Tmz1t_1897: Iron-sulfur cluster assembly protein SufD |
|
Gene: NE1448: Iron-sulfur cluster assembly protein SufD |
Gene: Nmul_A0698: Iron-sulfur cluster assembly protein SufD |
|
|
|
|
|
Gene: Mmol_1127: Iron-sulfur cluster assembly protein SufD |
|
Iron-sulfur cluster assembly protein SufD |
| sufS |
Gene: ebA6367: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Tmz1t_1896: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Daro_2137: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: NE1447: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Nmul_A0699: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
|
|
|
|
Gene: Mmol_1126: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| sufE2 |
Gene: ebD53: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: Tmz1t_1895: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
Gene: NE1446: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: Nmul_A0700: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
|
|
|
|
Gene: Mmol_1125: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
| sufE3 |
|
Gene: Tmz1t_2988: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
Gene: NE1445: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: Nmul_A0701: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
|
|
|
|
|
|
Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |