Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CV1911 gene

Properties
Regulog: IscR - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 27 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Laribacter hongkongensis HLHK9
Position: -63
Score: 6.39685
Sequence: ATGGTTGACTAAATTAGTCGGGTTT
Locus tag: LHK_02866
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: LHK_02865
Name: iscS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: LHK_02864
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: LHK_02863
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: LHK_02862
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: LHK_02861
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: LHK_02860
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: LHK_02859
Name: null
Funciton: YbaK/prolyl-tRNA synthetase associated region
Locus tag: LHK_02858
Name: yfhJ
Funciton: putative Fe-S cluster assembly protein
iscR-iscS2-iscU-iscA-hscB-hscA-fdx-LHK_02859-yfhJ -63 6.4 ATGGTTGACTAAATTAGTCGGGTTT LHK_02866