Regulon of IscR in Thiobacillus denitrificans

Properties
Regulator type:	Transcription factor
TF locus tag:	Tbd_1163
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.5 Sequence: ATAGTTGACTAAAATACTCGGAAAT Locus tag: Tbd_1162 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	Tbd_1162	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -88 Score: 6.2 Sequence: ATAGTTGACTAAATTGCTAAGGTAA Position: -60 Score: 6.5 Sequence: ATAGTTGACTGAAATGCTCGGGAAT Locus tag: Tbd_1163 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Tbd_1164 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Tbd_1165 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Tbd_1166 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Tbd_1167 Name: hscB Funciton: Chaperone protein HscB Locus tag: Tbd_1168 Name: hscA Funciton: Chaperone protein HscA Locus tag: Tbd_1169 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Tbd_1170 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Tbd_1163	iscR	Iron-sulfur cluster regulator IscR
	Tbd_1164	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Tbd_1165	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Tbd_1166	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Tbd_1167	hscB	Chaperone protein HscB
	Tbd_1168	hscA	Chaperone protein HscA
	Tbd_1169	fdx	ferredoxin, 2Fe-2S type, ISC system
	Tbd_1170	yfhJ	putative Fe-S cluster assembly protein
Position: -38 Score: 5.1 Sequence: ATTCCCGAGTATTCCACTCAGGTAT Locus tag: Tbd_2499 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	Tbd_2499	ydhD	Probable monothiol glutaredoxin ydhD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD