Regulon of IscR in Chromobacterium violaceum ATCC 12472

Properties
Regulator type:	Transcription factor
TF locus tag:	CV1095
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.6 Sequence: ATACTTGACTAATTTAGTCGGATAT Locus tag: CV1095 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: CV1094 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: CV1093 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: CV1092 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: CV1091 Name: hscB Funciton: Chaperone protein HscB Locus tag: CV1090 Name: null Funciton: hypothetical protein Locus tag: CV1089 Name: hscA Funciton: Chaperone protein HscA Locus tag: CV1088 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: CV1087 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	CV1095	iscR	Iron-sulfur cluster regulator IscR
	CV1094	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	CV1093	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	CV1092	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	CV1091	hscB	Chaperone protein HscB
	CV1090		hypothetical protein
	CV1089	hscA	Chaperone protein HscA
	CV1088	fdx	ferredoxin, 2Fe-2S type, ISC system
	CV1087	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD