Regulon of IscR in Azoarcus sp. EbN1

Properties
Regulator type:	Transcription factor
TF locus tag:	ebA6404
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 5.6 Sequence: GTAGTTGACCGATTTTGTCGGGTTA Position: -63 Score: 5.8 Sequence: ATAGTCGAGTGAAACGTTCGGGTAT Locus tag: ebA6404 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ebA6402 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ebA6401 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ebA6400 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: ebB230 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: ebA6397 Name: hscB Funciton: Chaperone protein HscB Locus tag: ebA6396 Name: hscA Funciton: Chaperone protein HscA Locus tag: ebB229 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: ebA6395 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	ebA6404	iscR	Iron-sulfur cluster regulator IscR
	ebA6402	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	ebA6401	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	ebA6400	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	ebB230	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	ebA6397	hscB	Chaperone protein HscB
	ebA6396	hscA	Chaperone protein HscA
	ebB229	fdx	ferredoxin, 2Fe-2S type, ISC system
	ebA6395	yfhJ	putative Fe-S cluster assembly protein
Position: -62 Score: 5.8 Sequence: AAACCCGACTAAACTAGTCGGGAAT Locus tag: ebA6405 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	ebA6405	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -39 Score: 5.2 Sequence: TTACCCGACTGAAACACTCAACTTT Locus tag: ebA1175 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	ebA1175	ydhD	Probable monothiol glutaredoxin ydhD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD