Regulon of IscR in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_2207
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 6.1 Sequence: ATAGTCGATTAAAATTCTCGGGAAT Locus tag: Tmz1t_2208 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	Tmz1t_2208	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -103 Score: 5.1 Sequence: TTAGTTGACCGTTTTTGTCGGGATC Position: -75 Score: 5.6 Sequence: ATACTCGACAAAAATGATGGGATAT Locus tag: Tmz1t_2207 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Tmz1t_2206 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Tmz1t_2205 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Tmz1t_2204 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Tmz1t_2203 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Tmz1t_2202 Name: hscB Funciton: Chaperone protein HscB Locus tag: Tmz1t_2201 Name: hscA Funciton: Chaperone protein HscA Locus tag: Tmz1t_2200 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Tmz1t_2199 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Tmz1t_2207	iscR	Iron-sulfur cluster regulator IscR
	Tmz1t_2206	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Tmz1t_2205	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Tmz1t_2204	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Tmz1t_2203	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Tmz1t_2202	hscB	Chaperone protein HscB
	Tmz1t_2201	hscA	Chaperone protein HscA
	Tmz1t_2200	fdx	ferredoxin, 2Fe-2S type, ISC system
	Tmz1t_2199	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD