Regulon of IscR in Methylotenera mobilis JLW8

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmol_1671
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.3 Sequence: ATAGTTGACTAAAATTGTAAGGAAT Locus tag: Mmol_1671 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Mmol_1672 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Mmol_1673 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Mmol_1671	iscR	Iron-sulfur cluster regulator IscR
	Mmol_1672	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Mmol_1673	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD