Regulon of IscR in Methylophilales bacterium HTCC2181

Properties
Regulator type:	Transcription factor
TF locus tag:	MB2181_02930
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6 Sequence: ATACTTGAGTTATTTACTCAGGATT Locus tag: MB2181_02935 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	MB2181_02935	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -58 Score: 5.6 Sequence: ATACTTGATAGTTTTAGTCAAGTAT Locus tag: MB2181_02930 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: MB2181_02925 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: MB2181_02920 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: MB2181_02915 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: MB2181_02910 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: MB2181_02905 Name: hscB Funciton: Chaperone protein HscB Locus tag: MB2181_02900 Name: hscA Funciton: Chaperone protein HscA Locus tag: MB2181_02895 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	MB2181_02930	iscR	Iron-sulfur cluster regulator IscR
	MB2181_02925	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	MB2181_02920	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	MB2181_02915	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	MB2181_02910	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	MB2181_02905	hscB	Chaperone protein HscB
	MB2181_02900	hscA	Chaperone protein HscA
	MB2181_02895	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD