Regulon of IscR in Laribacter hongkongensis HLHK9

Properties
Regulator type:	Transcription factor
TF locus tag:	LHK_02866
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.4 Sequence: ATGGTTGACTAAATTAGTCGGGTTT Locus tag: LHK_02866 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: LHK_02865 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: LHK_02864 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: LHK_02863 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: LHK_02862 Name: hscB Funciton: Chaperone protein HscB Locus tag: LHK_02861 Name: hscA Funciton: Chaperone protein HscA Locus tag: LHK_02860 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: LHK_02859 Name: null Funciton: YbaK/prolyl-tRNA synthetase associated region Locus tag: LHK_02858 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	LHK_02866	iscR	Iron-sulfur cluster regulator IscR
	LHK_02865	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	LHK_02864	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	LHK_02863	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	LHK_02862	hscB	Chaperone protein HscB
	LHK_02861	hscA	Chaperone protein HscA
	LHK_02860	fdx	ferredoxin, 2Fe-2S type, ISC system
	LHK_02859		YbaK/prolyl-tRNA synthetase associated region
	LHK_02858	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD