Regulon of IscR in Dechloromonas aromatica RCB

Properties
Regulator type:	Transcription factor
TF locus tag:	Daro_1948
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 6.1 Sequence: ATAGCTGACAAATTCAGTCGAGTAT Locus tag: Daro_1947 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	Daro_1947	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -82 Score: 5.2 Sequence: ATACCTGAGCAAAATAGTTGACTAA Position: -69 Score: 6.3 Sequence: ATAGTTGACTAATTTTCTCTGGTTT Position: -40 Score: 5.5 Sequence: ATAGTTGACCTTAATACTAGGTTAT Locus tag: Daro_1948 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Daro_1949 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Daro_1950 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Daro_1951 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Daro_1952 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Daro_1953 Name: hscB Funciton: Chaperone protein HscB Locus tag: Daro_1954 Name: hscA Funciton: Chaperone protein HscA Locus tag: Daro_1955 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Daro_1956 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Daro_1948	iscR	Iron-sulfur cluster regulator IscR
	Daro_1949	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Daro_1950	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Daro_1951	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Daro_1952	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Daro_1953	hscB	Chaperone protein HscB
	Daro_1954	hscA	Chaperone protein HscA
	Daro_1955	fdx	ferredoxin, 2Fe-2S type, ISC system
	Daro_1956	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD