Statistics of regulated genes

Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725	6	2
Caldicellulosiruptor saccharolyticus DSM 8903	6	2
Carboxydothermus hydrogenoformans Z-2901	7	2
Thermoanaerobacter ethanolicus X514	6	2
Thermoanaerobacter italicus Ab9	6	2
Thermoanaerobacter tengcongensis MB4	6	2
Moorella thermoacetica ATCC 39073	8	3

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
hrcA	* Anaerocellum thermophilum DSM 6725 Site: position = -43 score = 7.40307 sequence = TTAGCACTCATCAACAGAGAGTGCTAA Gene: Athe_1553: Heat shock response transcriptional regulator HrcA, HrcA family	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -43 score = 7.43261 sequence = TTAGCACTCATCAAATGAGAGTGCTAA Gene: Csac_1750: Heat shock response transcriptional regulator HrcA, HrcA family	* Carboxydothermus hydrogenoformans Z-2901 Site: position = -46 score = 7.60419 sequence = TTAGCACTCAACAAAAGAGAGTGCTAA Gene: CHY_0412: Heat shock response transcriptional regulator HrcA, HrcA family	* Thermoanaerobacter ethanolicus X514 Site: position = -47 score = 7.48761 sequence = TTAGCACTCAATCGAGTAGAGTGCTAA Gene: Teth514_2081: Heat shock response transcriptional regulator HrcA, HrcA family	* Thermoanaerobacter italicus Ab9 Site: position = -47 score = 7.71617 sequence = TTAGCACTCAACTTGATTGAGTGCTAA Gene: Thit_0892: Heat shock response transcriptional regulator HrcA, HrcA family	* Thermoanaerobacter tengcongensis MB4 Site: position = -47 score = 7.46072 sequence = TTAGCACTCAATGAGTGAGAGTGCTAA Gene: TTE0953: Heat shock response transcriptional regulator HrcA, HrcA family	* Moorella thermoacetica ATCC 39073 Site: position = -46 score = 6.72588 sequence = TTAGCACTCGGAACATAAGAGTGCTAA Gene: Moth_0583: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
groL2	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0413: Heat shock protein 60 family chaperone GroEL	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Moorella thermoacetica ATCC 39073	Heat shock protein 60 family chaperone GroEL
grpE	Anaerocellum thermophilum DSM 6725 Gene: Athe_1552: Heat shock protein GrpE	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1751: Heat shock protein GrpE	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0414: Heat shock protein GrpE	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2080: Heat shock protein GrpE	Thermoanaerobacter italicus Ab9 Gene: Thit_0893: Heat shock protein GrpE	Thermoanaerobacter tengcongensis MB4 Gene: TTE0954: Heat shock protein GrpE	Moorella thermoacetica ATCC 39073 Gene: Moth_0584: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Anaerocellum thermophilum DSM 6725 Gene: Athe_1551: Chaperone protein DnaK	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1752: Chaperone protein DnaK	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0415: Chaperone protein DnaK	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2079: Chaperone protein DnaK	Thermoanaerobacter italicus Ab9 Gene: Thit_0894: Chaperone protein DnaK	Thermoanaerobacter tengcongensis MB4 Gene: TTE0955: Chaperone protein DnaK	Moorella thermoacetica ATCC 39073 Gene: Moth_0585: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	Anaerocellum thermophilum DSM 6725 Gene: Athe_1550: Chaperone protein DnaJ	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1753: Chaperone protein DnaJ	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0416: Chaperone protein DnaJ	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2078: Chaperone protein DnaJ	Thermoanaerobacter italicus Ab9 Gene: Thit_0895: Chaperone protein DnaJ	Thermoanaerobacter tengcongensis MB4 Gene: TTE0956: Chaperone protein DnaJ	Moorella thermoacetica ATCC 39073 Gene: Moth_0586: Chaperone protein DnaJ	Chaperone protein DnaJ
CRON 2.
groS	* Anaerocellum thermophilum DSM 6725 Site: position = -54 score = 7.68586 sequence = TTAGCACTCATTGAAAGTGAGTGCTAA Gene: Athe_2138: Heat shock protein 60 family co-chaperone GroES	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -54 score = 7.55228 sequence = TTAGCACTCACTCTCAATGAGTGCTAA Gene: Csac_1291: Heat shock protein 60 family co-chaperone GroES	* Carboxydothermus hydrogenoformans Z-2901 Site: position = -67 score = 7.52483 sequence = TTAGCACTCTATCGAAGTGAGTGCTAA Gene: CHY_0806: Heat shock protein 60 family co-chaperone GroES	* Thermoanaerobacter ethanolicus X514 Site: position = -53 score = 7.75676 sequence = TTAGCACTCACATAAGTTGAGTGCTAA Gene: Teth514_0512: Heat shock protein 60 family co-chaperone GroES	* Thermoanaerobacter italicus Ab9 Site: position = -53 score = 7.75676 sequence = TTAGCACTCACATAAGTTGAGTGCTAA Gene: Thit_0563: Heat shock protein 60 family co-chaperone GroES	* Thermoanaerobacter tengcongensis MB4 Site: position = -54 score = 7.56724 sequence = TTAGCACTCATAGAAGTTGAGTGCTAA Gene: TTE0579: Heat shock protein 60 family co-chaperone GroES	*2 Moorella thermoacetica ATCC 39073 Site: position = -61 score = 6.69853 sequence = TTAGCACTTGAGTCCGGTGAGTGCTAA Gene: Moth_0545: Heat shock protein 60 family co-chaperone GroES Site: position = -50 score = 6.82089 sequence = CTAGCACTCTCTAAAATAAAGTGCTAA Gene: Moth_2130: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Anaerocellum thermophilum DSM 6725 Gene: Athe_2137: Heat shock protein 60 family chaperone GroEL	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1292: Heat shock protein 60 family chaperone GroEL	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0807: Heat shock protein 60 family chaperone GroEL	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0513: Heat shock protein 60 family chaperone GroEL	Thermoanaerobacter italicus Ab9 Gene: Thit_0564: Heat shock protein 60 family chaperone GroEL	Thermoanaerobacter tengcongensis MB4 Gene: TTE0580: Heat shock protein 60 family chaperone GroEL	2 Moorella thermoacetica ATCC 39073 Gene: Moth_2129: Heat shock protein 60 family chaperone GroEL Gene: Moth_0546: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD