Regulog HrcA - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Thermoanaerobacterales
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | 6 | 2 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | 6 | 2 |
| Carboxydothermus hydrogenoformans Z-2901 | 7 | 2 |
| Thermoanaerobacter ethanolicus X514 | 6 | 2 |
| Thermoanaerobacter italicus Ab9 | 6 | 2 |
| Thermoanaerobacter tengcongensis MB4 | 6 | 2 |
| Moorella thermoacetica ATCC 39073 | 8 | 3 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| hrcA |
*
Anaerocellum thermophilum DSM 6725 Site: position = -43 score = 7.40307 sequence = TTAGCACTCATCAACAGAGAGTGCTAA Gene: Athe_1553: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -43 score = 7.43261 sequence = TTAGCACTCATCAAATGAGAGTGCTAA Gene: Csac_1750: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Carboxydothermus hydrogenoformans Z-2901 Site: position = -46 score = 7.60419 sequence = TTAGCACTCAACAAAAGAGAGTGCTAA Gene: CHY_0412: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Thermoanaerobacter ethanolicus X514 Site: position = -47 score = 7.48761 sequence = TTAGCACTCAATCGAGTAGAGTGCTAA Gene: Teth514_2081: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Thermoanaerobacter italicus Ab9 Site: position = -47 score = 7.71617 sequence = TTAGCACTCAACTTGATTGAGTGCTAA Gene: Thit_0892: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -47 score = 7.46072 sequence = TTAGCACTCAATGAGTGAGAGTGCTAA Gene: TTE0953: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Moorella thermoacetica ATCC 39073 Site: position = -46 score = 6.72588 sequence = TTAGCACTCGGAACATAAGAGTGCTAA Gene: Moth_0583: Heat shock response transcriptional regulator HrcA, HrcA family |
Heat shock response transcriptional regulator HrcA, HrcA family |
| groL2 |
|
|
Gene: CHY_0413: Heat shock protein 60 family chaperone GroEL |
|
|
|
|
Heat shock protein 60 family chaperone GroEL |
| grpE |
Gene: Athe_1552: Heat shock protein GrpE |
Gene: Csac_1751: Heat shock protein GrpE |
Gene: CHY_0414: Heat shock protein GrpE |
Gene: Teth514_2080: Heat shock protein GrpE |
Gene: Thit_0893: Heat shock protein GrpE |
Gene: TTE0954: Heat shock protein GrpE |
Gene: Moth_0584: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: Athe_1551: Chaperone protein DnaK |
Gene: Csac_1752: Chaperone protein DnaK |
Gene: CHY_0415: Chaperone protein DnaK |
Gene: Teth514_2079: Chaperone protein DnaK |
Gene: Thit_0894: Chaperone protein DnaK |
Gene: TTE0955: Chaperone protein DnaK |
Gene: Moth_0585: Chaperone protein DnaK |
Chaperone protein DnaK |
| dnaJ |
Gene: Athe_1550: Chaperone protein DnaJ |
Gene: Csac_1753: Chaperone protein DnaJ |
Gene: CHY_0416: Chaperone protein DnaJ |
Gene: Teth514_2078: Chaperone protein DnaJ |
Gene: Thit_0895: Chaperone protein DnaJ |
Gene: TTE0956: Chaperone protein DnaJ |
Gene: Moth_0586: Chaperone protein DnaJ |
Chaperone protein DnaJ |
| CRON 2. | ||||||||
| groS |
*
Anaerocellum thermophilum DSM 6725 Site: position = -54 score = 7.68586 sequence = TTAGCACTCATTGAAAGTGAGTGCTAA Gene: Athe_2138: Heat shock protein 60 family co-chaperone GroES |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -54 score = 7.55228 sequence = TTAGCACTCACTCTCAATGAGTGCTAA Gene: Csac_1291: Heat shock protein 60 family co-chaperone GroES |
*
Carboxydothermus hydrogenoformans Z-2901 Site: position = -67 score = 7.52483 sequence = TTAGCACTCTATCGAAGTGAGTGCTAA Gene: CHY_0806: Heat shock protein 60 family co-chaperone GroES |
*
Thermoanaerobacter ethanolicus X514 Site: position = -53 score = 7.75676 sequence = TTAGCACTCACATAAGTTGAGTGCTAA Gene: Teth514_0512: Heat shock protein 60 family co-chaperone GroES |
*
Thermoanaerobacter italicus Ab9 Site: position = -53 score = 7.75676 sequence = TTAGCACTCACATAAGTTGAGTGCTAA Gene: Thit_0563: Heat shock protein 60 family co-chaperone GroES |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -54 score = 7.56724 sequence = TTAGCACTCATAGAAGTTGAGTGCTAA Gene: TTE0579: Heat shock protein 60 family co-chaperone GroES |
*2
Moorella thermoacetica ATCC 39073 Site: position = -61 score = 6.69853 sequence = TTAGCACTTGAGTCCGGTGAGTGCTAA Gene: Moth_0545: Heat shock protein 60 family co-chaperone GroES Site: position = -50 score = 6.82089 sequence = CTAGCACTCTCTAAAATAAAGTGCTAA Gene: Moth_2130: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: Athe_2137: Heat shock protein 60 family chaperone GroEL |
Gene: Csac_1292: Heat shock protein 60 family chaperone GroEL |
Gene: CHY_0807: Heat shock protein 60 family chaperone GroEL |
Gene: Teth514_0513: Heat shock protein 60 family chaperone GroEL |
Gene: Thit_0564: Heat shock protein 60 family chaperone GroEL |
Gene: TTE0580: Heat shock protein 60 family chaperone GroEL |
2
Moorella thermoacetica ATCC 39073 Gene: Moth_2129: Heat shock protein 60 family chaperone GroEL Gene: Moth_0546: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |