Regulon of HrcA in Caldicellulosiruptor saccharolyticus DSM 8903

Properties
Regulator type:	Transcription factor
TF locus tag:	Csac_1750
Regulator family:	HrcA
Regulation mode:
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Thermoanaerobacterales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 7.4 Sequence: TTAGCACTCATCAAATGAGAGTGCTAA Locus tag: Csac_1750 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Csac_1751 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Csac_1752 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Csac_1753 Name: dnaJ Funciton: Chaperone protein DnaJ
	Csac_1750	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Csac_1751	grpE	Heat shock protein GrpE
	Csac_1752	dnaK	Chaperone protein DnaK
	Csac_1753	dnaJ	Chaperone protein DnaJ
Position: -54 Score: 7.6 Sequence: TTAGCACTCACTCTCAATGAGTGCTAA Locus tag: Csac_1291 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Csac_1292 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Csac_1291	groS	Heat shock protein 60 family co-chaperone GroES
	Csac_1292	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD