Regulon of HrcA in Carboxydothermus hydrogenoformans Z-2901

Properties
Regulator type:	Transcription factor
TF locus tag:	CHY_0412
Regulator family:	HrcA
Regulation mode:
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Thermoanaerobacterales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 7.5 Sequence: TTAGCACTCTATCGAAGTGAGTGCTAA Locus tag: CHY_0806 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CHY_0807 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	CHY_0806	groS	Heat shock protein 60 family co-chaperone GroES
	CHY_0807	groL	Heat shock protein 60 family chaperone GroEL
Position: -46 Score: 7.6 Sequence: TTAGCACTCAACAAAAGAGAGTGCTAA Locus tag: CHY_0412 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: CHY_0413 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL Locus tag: CHY_0414 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CHY_0415 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: CHY_0416 Name: dnaJ Funciton: Chaperone protein DnaJ
	CHY_0412	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	CHY_0413	groL2	Heat shock protein 60 family chaperone GroEL
	CHY_0414	grpE	Heat shock protein GrpE
	CHY_0415	dnaK	Chaperone protein DnaK
	CHY_0416	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD