Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hrcA gene

Properties
Regulog: HrcA - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode:
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -43
Score: 7.40307
Sequence: TTAGCACTCATCAACAGAGAGTGCTAA
Locus tag: Athe_1553
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: Athe_1552
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Athe_1551
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Athe_1550
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -43 7.4 TTAGCACTCATCAACAGAGAGTGCTAA Athe_1553
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -43
Score: 7.43261
Sequence: TTAGCACTCATCAAATGAGAGTGCTAA
Locus tag: Csac_1750
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: Csac_1751
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Csac_1752
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Csac_1753
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -43 7.4 TTAGCACTCATCAAATGAGAGTGCTAA Csac_1750
Carboxydothermus hydrogenoformans Z-2901
Position: -46
Score: 7.60419
Sequence: TTAGCACTCAACAAAAGAGAGTGCTAA
Locus tag: CHY_0412
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: CHY_0413
Name: groL2
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: CHY_0414
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: CHY_0415
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: CHY_0416
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-groL2-grpE-dnaK-dnaJ -46 7.6 TTAGCACTCAACAAAAGAGAGTGCTAA CHY_0412
Moorella thermoacetica ATCC 39073
Position: -46
Score: 6.72588
Sequence: TTAGCACTCGGAACATAAGAGTGCTAA
Locus tag: Moth_0583
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: Moth_0584
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Moth_0585
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Moth_0586
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -46 6.7 TTAGCACTCGGAACATAAGAGTGCTAA Moth_0583
Thermoanaerobacter ethanolicus X514
Position: -47
Score: 7.48761
Sequence: TTAGCACTCAATCGAGTAGAGTGCTAA
Locus tag: Teth514_2081
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: Teth514_2080
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Teth514_2079
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Teth514_2078
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -47 7.5 TTAGCACTCAATCGAGTAGAGTGCTAA Teth514_2081
Thermoanaerobacter italicus Ab9
Position: -47
Score: 7.71617
Sequence: TTAGCACTCAACTTGATTGAGTGCTAA
Locus tag: Thit_0892
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: Thit_0893
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Thit_0894
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Thit_0895
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -47 7.7 TTAGCACTCAACTTGATTGAGTGCTAA Thit_0892
Thermoanaerobacter tengcongensis MB4
Position: -47
Score: 7.46072
Sequence: TTAGCACTCAATGAGTGAGAGTGCTAA
Locus tag: TTE0953
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: TTE0954
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: TTE0955
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: TTE0956
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -47 7.5 TTAGCACTCAATGAGTGAGAGTGCTAA TTE0953