Regulon of HrcA in Thermoanaerobacter ethanolicus X514

Properties
Regulator type:	Transcription factor
TF locus tag:	Teth514_2081
Regulator family:	HrcA
Regulation mode:
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Thermoanaerobacterales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.5 Sequence: TTAGCACTCAATCGAGTAGAGTGCTAA Locus tag: Teth514_2081 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Teth514_2080 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Teth514_2079 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Teth514_2078 Name: dnaJ Funciton: Chaperone protein DnaJ
	Teth514_2081	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Teth514_2080	grpE	Heat shock protein GrpE
	Teth514_2079	dnaK	Chaperone protein DnaK
	Teth514_2078	dnaJ	Chaperone protein DnaJ
Position: -53 Score: 7.8 Sequence: TTAGCACTCACATAAGTTGAGTGCTAA Locus tag: Teth514_0512 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Teth514_0513 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Teth514_0512	groS	Heat shock protein 60 family co-chaperone GroES
	Teth514_0513	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD