Regulon of HrcA in Thermoanaerobacter italicus Ab9

Properties
Regulator type:	Transcription factor
TF locus tag:	Thit_0892
Regulator family:	HrcA
Regulation mode:
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Thermoanaerobacterales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.7 Sequence: TTAGCACTCAACTTGATTGAGTGCTAA Locus tag: Thit_0892 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Thit_0893 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Thit_0894 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Thit_0895 Name: dnaJ Funciton: Chaperone protein DnaJ
	Thit_0892	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Thit_0893	grpE	Heat shock protein GrpE
	Thit_0894	dnaK	Chaperone protein DnaK
	Thit_0895	dnaJ	Chaperone protein DnaJ
Position: -53 Score: 7.8 Sequence: TTAGCACTCACATAAGTTGAGTGCTAA Locus tag: Thit_0563 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Thit_0564 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Thit_0563	groS	Heat shock protein 60 family co-chaperone GroES
	Thit_0564	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD