Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing groL2 gene

Properties
Regulog: HrcA - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode:
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Carboxydothermus hydrogenoformans Z-2901
Position: -46
Score: 7.60419
Sequence: TTAGCACTCAACAAAAGAGAGTGCTAA
Locus tag: CHY_0412
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: CHY_0413
Name: groL2
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: CHY_0414
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: CHY_0415
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: CHY_0416
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-groL2-grpE-dnaK-dnaJ -46 7.6 TTAGCACTCAACAAAAGAGAGTGCTAA CHY_0412