Regulon of HrcA in Moorella thermoacetica ATCC 39073

Properties
Regulator type:	Transcription factor
TF locus tag:	Moth_0583
Regulator family:	HrcA
Regulation mode:
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Thermoanaerobacterales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.7 Sequence: TTAGCACTCGGAACATAAGAGTGCTAA Locus tag: Moth_0583 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Moth_0584 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Moth_0585 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Moth_0586 Name: dnaJ Funciton: Chaperone protein DnaJ
	Moth_0583	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Moth_0584	grpE	Heat shock protein GrpE
	Moth_0585	dnaK	Chaperone protein DnaK
	Moth_0586	dnaJ	Chaperone protein DnaJ
Position: -50 Score: 6.8 Sequence: CTAGCACTCTCTAAAATAAAGTGCTAA Locus tag: Moth_2130 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Moth_2129 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Moth_2130	groS	Heat shock protein 60 family co-chaperone GroES
	Moth_2129	groL	Heat shock protein 60 family chaperone GroEL
Position: -61 Score: 6.7 Sequence: TTAGCACTTGAGTCCGGTGAGTGCTAA Locus tag: Moth_0545 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Moth_0546 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Moth_0545	groS	Heat shock protein 60 family co-chaperone GroES
	Moth_0546	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD