Regulog HrcA - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Micrococcineae
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter sp. FB24 | 7 | 4 |
| Arthrobacter aurescens TC1 | 4 | 3 |
| Arthrobacter chlorophenolicus A6 | 7 | 4 |
| Beutenbergia cavernae DSM 12333 | 5 | 4 |
| Brachybacterium faecium DSM 4810 | 6 | 3 |
| Brevibacterium linens BL2 | 3 | 2 |
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 6 | 4 |
| Janibacter sp. HTCC2649 | 6 | 3 |
| Jonesia denitrificans DSM 20603 | 6 | 4 |
| Kocuria rhizophila DC2201 | 7 | 4 |
| Kytococcus sedentarius DSM 20547 | 6 | 3 |
| Leifsonia xyli subsp. xyli str. CTCB07 | 7 | 5 |
| Renibacterium salmoninarum ATCC 33209 | 6 | 3 |
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| hsp18 |
|
|
|
|
|
Gene: BlinB01003008: Small heat shock protein 18 |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -97 score = 6.64098 sequence = TTGGCACTCCCCTGCGTCGAGTGCTAA Gene: CMM_2092: Small heat shock protein 18 |
|
|
*
Kocuria rhizophila DC2201 Site: position = -117 score = 6.30544 sequence = TTGGCACTCTGCTGGACCGAGTGCTAT Gene: KRH_22230: Small heat shock protein 18 |
|
*2
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -91 score = 6.96307 sequence = TTAGCACTCTCCATGGGTGAGTGCTAA Gene: Lxx07755: Small heat shock protein 18 Site: position = -91 score = 6.96307 sequence = TTAGCACTCTCCATGGGTGAGTGCTAA Gene: Lxx22708: Small heat shock protein 18 |
|
|
Small heat shock protein 18 |
| CRON 2. | |||||||||||||||
| COG2331 |
*
Arthrobacter sp. FB24 Site: position = -112 score = 6.40122 sequence = TTAGCACTCAGGCCCTGCGACTGCTAA Gene: Arth_2866: Conserved hypothetical protein |
*
Arthrobacter aurescens TC1 Site: position = -87 score = 6.35264 sequence = TTGGCACTCAGGCCCTGCGACTGCTAA Gene: AAur_2854: Conserved hypothetical protein |
*
Arthrobacter chlorophenolicus A6 Site: position = -90 score = 6.40122 sequence = TTAGCACTCAGGCCCTGCGACTGCTAA Gene: Achl_2573: Conserved hypothetical protein |
*
Beutenbergia cavernae DSM 12333 Site: position = -64 score = 5.9172 sequence = TTGGCACTCGGTAGTGACAAGTGCTAG Gene: Bcav_0902: Conserved hypothetical protein |
Gene: Bfae_13090: Conserved hypothetical protein |
|
Gene: CMM_2448: Conserved hypothetical protein |
Gene: JNB_16878: Conserved hypothetical protein |
*
Jonesia denitrificans DSM 20603 Site: position = -77 score = 5.94984 sequence = TTAGCACTCAGAAGATGAGAGTGCTGG Gene: Jden_1970: Conserved hypothetical protein |
2
Kocuria rhizophila DC2201 Gene: KRH_06860: Conserved hypothetical protein Gene: KRH_22990: Conserved hypothetical protein |
Gene: Ksed_23900: Conserved hypothetical protein |
Gene: Lxx05895: Conserved hypothetical protein |
Gene: RSal33209_1752: Conserved hypothetical protein |
|
Conserved hypothetical protein |
| CRON 3. | |||||||||||||||
| hrcA |
*
Arthrobacter sp. FB24 Site: position = -95 score = 6.25461 sequence = TTAGCACTTAGACATGTCGAGTGCTAA Gene: Arth_2236: Heat shock response transcriptional regulator HrcA, HrcA family |
Gene: AAur_2235: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Arthrobacter chlorophenolicus A6 Site: position = -110 score = 6.24363 sequence = TTAGCACTTAGGCATGTCGAGTGCTAA Gene: Achl_1973: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Beutenbergia cavernae DSM 12333 Site: position = -47 score = 6.40594 sequence = TTGGCACTCGGCCCGGGTGAGTGCTGG Gene: Bcav_1748: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Brachybacterium faecium DSM 4810 Site: position = -98 score = 5.98638 sequence = TTGGCACCTGGCACGGCAGAGTGCCAG Gene: Bfae_17300: Heat shock response transcriptional regulator HrcA, HrcA family |
Gene: BlinB01000188: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -39 score = 5.86703 sequence = TTGGCAGTCAGAACCGACGAGTGCCAG Gene: CMM_1564: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Janibacter sp. HTCC2649 Site: position = -48 score = 6.24417 sequence = TTGGCACTCACCAAGCATGAGTGCCAG Gene: JNB_05025: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Jonesia denitrificans DSM 20603 Site: position = -50 score = 6.62301 sequence = TTGGCACTCGGCAGTGGGGAGTGCCAA Gene: Jden_1550: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Kocuria rhizophila DC2201 Site: position = -90 score = 6.08158 sequence = TTAGCACTGTGCGCGGATGAGTGCCAA Gene: KRH_13010: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Kytococcus sedentarius DSM 20547 Site: position = -75 score = 5.87878 sequence = CTGGCACTTGACGTCCCCGAGTGCCAG Gene: Ksed_11690: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -49 score = 6.48651 sequence = TTGGCACTCAGGATCAGCGAGTGCTAA Gene: Lxx14650: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Renibacterium salmoninarum ATCC 33209 Site: position = -233 score = 6.53907 sequence = TTAGCACTTGGGCAAGCCGAGTGCTAA Gene: RSal33209_1927: Heat shock response transcriptional regulator HrcA, HrcA family |
|
Heat shock response transcriptional regulator HrcA, HrcA family |
| dnaJ |
Gene: Arth_2235: Chaperone protein DnaJ |
Gene: AAur_2234: Chaperone protein DnaJ |
Gene: Achl_1972: Chaperone protein DnaJ |
Gene: Bcav_1749: Chaperone protein DnaJ |
Gene: Bfae_17290: Chaperone protein DnaJ |
Gene: BlinB01000187: Chaperone protein DnaJ |
Gene: CMM_1565: Chaperone protein DnaJ |
Gene: JNB_05020: Chaperone protein DnaJ |
Gene: Jden_1549: Chaperone protein DnaJ |
Gene: KRH_13000: Chaperone protein DnaJ |
Gene: Ksed_11700: Chaperone protein DnaJ |
Gene: Lxx14640: Chaperone protein DnaJ |
Gene: RSal33209_1926: Chaperone protein DnaJ |
|
Chaperone protein DnaJ |
| rsmE |
Gene: Arth_2234: 16S ribosomal RNA methyltransferase |
Gene: AAur_2233: 16S ribosomal RNA methyltransferase |
Gene: Achl_1971: 16S ribosomal RNA methyltransferase |
|
Gene: Bfae_17280: 16S ribosomal RNA methyltransferase |
Gene: BlinB01000186: 16S ribosomal RNA methyltransferase |
Gene: CMM_1566: 16S ribosomal RNA methyltransferase |
Gene: JNB_05015: 16S ribosomal RNA methyltransferase |
Gene: Jden_1548: 16S ribosomal RNA methyltransferase |
Gene: KRH_12990: 16S ribosomal RNA methyltransferase |
Gene: Ksed_11710: 16S ribosomal RNA methyltransferase |
Gene: Lxx14630: 16S ribosomal RNA methyltransferase |
Gene: RSal33209_1925: 16S ribosomal RNA methyltransferase |
|
16S ribosomal RNA methyltransferase |
| CRON 4. | |||||||||||||||
| groL2 |
*
Arthrobacter sp. FB24 Site: position = -244 score = 6.66381 sequence = CTTGCACTCTCCCCGGGGGAGTGCTAA Site: position = -209 score = 6.31988 sequence = TTAGCACTCCCACGGACTGACTGCTAA Gene: Arth_0779: Heat shock protein 60 family chaperone GroEL |
*
Arthrobacter aurescens TC1 Site: position = -245 score = 6.63936 sequence = CTTGCACTCTCCCCGGTCGAGTGCTAA Site: position = -210 score = 5.96981 sequence = TTAGCACTCCTATGGTTCGACTGCTAA Gene: AAur_1001: Heat shock protein 60 family chaperone GroEL |
*
Arthrobacter chlorophenolicus A6 Site: position = -204 score = 6.34222 sequence = TTAGCACTCTGACGTACCGACTGCTAA Site: position = -239 score = 6.54296 sequence = CTTGCACTCTCACCGGGGGAGTGCTAA Gene: Achl_0894: Heat shock protein 60 family chaperone GroEL |
*
Beutenbergia cavernae DSM 12333 Site: position = -177 score = 6.47859 sequence = CTTGCACTCGCAGGAGGAGAGTGCCAA Site: position = -143 score = 6.35018 sequence = TTAGCACTCTCACCACGAGAGTGACAA Gene: Bcav_0821: Heat shock protein 60 family chaperone GroEL |
*
Brachybacterium faecium DSM 4810 Site: position = -246 score = 6.27048 sequence = TTAGCACTCTCCGCCGTCGAGTGCTTA Site: position = -212 score = 5.5793 sequence = CTGGCACTCGTGGATCGAGAGTGACAG Gene: Bfae_07610: Heat shock protein 60 family chaperone GroEL |
*
Brevibacterium linens BL2 Site: position = -184 score = 6.78526 sequence = TTTGCACTCGCATGGGGAGAGTGCTAA Gene: BlinB01000562: Heat shock protein 60 family chaperone GroEL |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -71 score = 6.29897 sequence = CTGGCACTCCCTCACGGGGAGTGCTAG Site: position = -106 score = 6.29597 sequence = CTTGCACTCCCGTAGGGCGAGTGCCAG Gene: CMM_2478: Heat shock protein 60 family chaperone GroEL |
*
Janibacter sp. HTCC2649 Site: position = -155 score = 6.35096 sequence = TTGGCACTCTCCTTAAAGGAGTGCCAA Site: position = -189 score = 6.5077 sequence = TTTGCACTCTCCACCCGAGAGTGCCAA Gene: JNB_16609: Heat shock protein 60 family chaperone GroEL |
*
Jonesia denitrificans DSM 20603 Site: position = -180 score = 6.47072 sequence = CTTGCACTCTCCATGCGAGAGTGCCAA Site: position = -146 score = 6.40248 sequence = TTGGCACTCTCGCATGGAGAGTGATAA Gene: Jden_2055: Heat shock protein 60 family chaperone GroEL |
*
Kocuria rhizophila DC2201 Site: position = -176 score = 6.16191 sequence = TTAGCACTCAGTCGAGTGGACTGCTAA Gene: KRH_18370: Heat shock protein 60 family chaperone GroEL |
*
Kytococcus sedentarius DSM 20547 Site: position = -217 score = 6.07478 sequence = TTGGCACTCGGCGGCTCCGAGTGACAG Gene: Ksed_21770: Heat shock protein 60 family chaperone GroEL |
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -70 score = 6.63486 sequence = TTAGCACTCCGCCTTACCGAGTGCTAA Site: position = -104 score = 5.91792 sequence = CTTGCACTCCACCGCGACGAGTGCCAG Gene: Lxx18010: Heat shock protein 60 family chaperone GroEL |
*
Renibacterium salmoninarum ATCC 33209 Site: position = -206 score = 6.28506 sequence = CTTGCACTCTCACCCTTCGAGTGCTAA Site: position = -171 score = 6.46146 sequence = TTAGCACTCTCCCGTTCTGACTGCTAA Gene: RSal33209_0482: Heat shock protein 60 family chaperone GroEL |
Gene: TW441: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 5. | |||||||||||||||
| groS |
*
Arthrobacter sp. FB24 Site: position = -185 score = 6.75516 sequence = CTGGCACTCGCCTTGACCGAGTGCTAA Site: position = -138 score = 6.75128 sequence = TTAGCACTCTCCCTAGGAGGGTGCTAA Gene: Arth_2887: Heat shock protein 60 family co-chaperone GroES |
*
Arthrobacter aurescens TC1 Site: position = -122 score = 6.72155 sequence = TTAGCACTCTCCCCCGGAGGGTGCTAA Site: position = -167 score = 6.64992 sequence = CTGGCACTCACCTTGACCGAGTGCTAA Gene: AAur_2875: Heat shock protein 60 family co-chaperone GroES |
*
Arthrobacter chlorophenolicus A6 Site: position = -136 score = 6.75536 sequence = TTAGCACTCTCCCGAGGAGGGTGCTAA Site: position = -182 score = 6.75516 sequence = CTGGCACTCGCCTTGACCGAGTGCTAA Gene: Achl_2595: Heat shock protein 60 family co-chaperone GroES |
*
Beutenbergia cavernae DSM 12333 Site: position = -180 score = 6.90065 sequence = TTGGCACTCGCCTTGACCGAGTGCTAA Gene: Bcav_3058: Heat shock protein 60 family co-chaperone GroES |
*
Brachybacterium faecium DSM 4810 Site: position = -132 score = 6.10539 sequence = TTGGCAGTCGACGGCCGAGAGTGCCAG Site: position = -182 score = 6.33062 sequence = TTAGCACTCGTGTTGCGTGAGTGCCAG Gene: Bfae_08630: Heat shock protein 60 family co-chaperone GroES |
*
Brevibacterium linens BL2 Site: position = -182 score = 6.56878 sequence = TTGGCACTCGAGTTGACCGAGTGCTAA Site: position = -137 score = 6.05631 sequence = TTAGCACTAGCACTCAGTGAGTGCCAG Gene: BlinB01001687: Heat shock protein 60 family co-chaperone GroES |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -65 score = 6.38642 sequence = CTGGCACTCTCCTCGGGAGATTGCCAA Site: position = -112 score = 6.48522 sequence = TTGGCACTCGCGTTGCGCGAGTGCAAG Gene: CMM_2568: Heat shock protein 60 family co-chaperone GroES |
*
Janibacter sp. HTCC2649 Site: position = -137 score = 6.78376 sequence = TTGGCACTCGCCCTGTGTGAGTGCCAG Site: position = -185 score = 6.56878 sequence = TTGGCACTCGAGTTGACCGAGTGCTAA Gene: JNB_17483: Heat shock protein 60 family co-chaperone GroES |
*
Jonesia denitrificans DSM 20603 Site: position = -146 score = 6.90065 sequence = TTGGCACTCGCCTTGACCGAGTGCTAA Gene: Jden_0635: Heat shock protein 60 family co-chaperone GroES |
*
Kocuria rhizophila DC2201 Site: position = -158 score = 6.83007 sequence = TTAGCACTCTCCCAGGGAGGGTGCTAA Gene: KRH_06750: Heat shock protein 60 family co-chaperone GroES |
*
Kytococcus sedentarius DSM 20547 Site: position = -183 score = 6.22922 sequence = CTGGCACTCGAGTTGACCGAGTGCCAG Site: position = -136 score = 6.0645 sequence = TTGGCACTCAGCGTCGTCGGGTGCCAG Gene: Ksed_07560: Heat shock protein 60 family co-chaperone GroES |
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -59 score = 5.968 sequence = TTAGCACTCTCATCATGAGGTTGCTAA Site: position = -106 score = 5.98626 sequence = TTGGCACTTACGTTGCGTGACTGCTAA Gene: Lxx19880: Heat shock protein 60 family co-chaperone GroES |
*
Renibacterium salmoninarum ATCC 33209 Site: position = -177 score = 6.79542 sequence = TTGGCACTCACCTTGACCGAGTGCTAA Site: position = -130 score = 6.386 sequence = TTAGCACTCTCGTACTGAGGGTGCTAA Gene: RSal33209_1769: Heat shock protein 60 family co-chaperone GroES |
Gene: TW074: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: Arth_2886: Heat shock protein 60 family chaperone GroEL |
Gene: AAur_2874: Heat shock protein 60 family chaperone GroEL |
Gene: Achl_2594: Heat shock protein 60 family chaperone GroEL |
|
Gene: Bfae_08640: Heat shock protein 60 family chaperone GroEL |
Gene: BlinB01001686: Heat shock protein 60 family chaperone GroEL |
|
Gene: JNB_17488: Heat shock protein 60 family chaperone GroEL |
|
Gene: KRH_06760: Heat shock protein 60 family chaperone GroEL |
Gene: Ksed_07570: Heat shock protein 60 family chaperone GroEL |
|
Gene: RSal33209_1768: Heat shock protein 60 family chaperone GroEL |
|
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |