Statistics of regulated genes

Genome	Genes	Operons
Arthrobacter sp. FB24	7	4
Arthrobacter aurescens TC1	4	3
Arthrobacter chlorophenolicus A6	7	4
Beutenbergia cavernae DSM 12333	5	4
Brachybacterium faecium DSM 4810	6	3
Brevibacterium linens BL2	3	2
Clavibacter michiganensis subsp. michiganensis NCPPB 382	6	4
Janibacter sp. HTCC2649	6	3
Jonesia denitrificans DSM 20603	6	4
Kocuria rhizophila DC2201	7	4
Kytococcus sedentarius DSM 20547	6	3
Leifsonia xyli subsp. xyli str. CTCB07	7	5
Renibacterium salmoninarum ATCC 33209	6	3
Tropheryma whipplei str. Twist

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes															Function
CRON 1.
hsp18	Arthrobacter sp. FB24	Arthrobacter aurescens TC1	Arthrobacter chlorophenolicus A6	Beutenbergia cavernae DSM 12333	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2 Gene: BlinB01003008: Small heat shock protein 18	* Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -97 score = 6.64098 sequence = TTGGCACTCCCCTGCGTCGAGTGCTAA Gene: CMM_2092: Small heat shock protein 18	Janibacter sp. HTCC2649	Jonesia denitrificans DSM 20603	* Kocuria rhizophila DC2201 Site: position = -117 score = 6.30544 sequence = TTGGCACTCTGCTGGACCGAGTGCTAT Gene: KRH_22230: Small heat shock protein 18	Kytococcus sedentarius DSM 20547	*2 Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -91 score = 6.96307 sequence = TTAGCACTCTCCATGGGTGAGTGCTAA Gene: Lxx07755: Small heat shock protein 18 Site: position = -91 score = 6.96307 sequence = TTAGCACTCTCCATGGGTGAGTGCTAA Gene: Lxx22708: Small heat shock protein 18	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Small heat shock protein 18
CRON 2.
COG2331	* Arthrobacter sp. FB24 Site: position = -112 score = 6.40122 sequence = TTAGCACTCAGGCCCTGCGACTGCTAA Gene: Arth_2866: Conserved hypothetical protein	* Arthrobacter aurescens TC1 Site: position = -87 score = 6.35264 sequence = TTGGCACTCAGGCCCTGCGACTGCTAA Gene: AAur_2854: Conserved hypothetical protein	* Arthrobacter chlorophenolicus A6 Site: position = -90 score = 6.40122 sequence = TTAGCACTCAGGCCCTGCGACTGCTAA Gene: Achl_2573: Conserved hypothetical protein	* Beutenbergia cavernae DSM 12333 Site: position = -64 score = 5.9172 sequence = TTGGCACTCGGTAGTGACAAGTGCTAG Gene: Bcav_0902: Conserved hypothetical protein	Brachybacterium faecium DSM 4810 Gene: Bfae_13090: Conserved hypothetical protein	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_2448: Conserved hypothetical protein	Janibacter sp. HTCC2649 Gene: JNB_16878: Conserved hypothetical protein	* Jonesia denitrificans DSM 20603 Site: position = -77 score = 5.94984 sequence = TTAGCACTCAGAAGATGAGAGTGCTGG Gene: Jden_1970: Conserved hypothetical protein	2 Kocuria rhizophila DC2201 Gene: KRH_06860: Conserved hypothetical protein Gene: KRH_22990: Conserved hypothetical protein	Kytococcus sedentarius DSM 20547 Gene: Ksed_23900: Conserved hypothetical protein	Leifsonia xyli subsp. xyli str. CTCB07 Gene: Lxx05895: Conserved hypothetical protein	Renibacterium salmoninarum ATCC 33209 Gene: RSal33209_1752: Conserved hypothetical protein	Tropheryma whipplei str. Twist	Conserved hypothetical protein
CRON 3.
hrcA	* Arthrobacter sp. FB24 Site: position = -95 score = 6.25461 sequence = TTAGCACTTAGACATGTCGAGTGCTAA Gene: Arth_2236: Heat shock response transcriptional regulator HrcA, HrcA family	Arthrobacter aurescens TC1 Gene: AAur_2235: Heat shock response transcriptional regulator HrcA, HrcA family	* Arthrobacter chlorophenolicus A6 Site: position = -110 score = 6.24363 sequence = TTAGCACTTAGGCATGTCGAGTGCTAA Gene: Achl_1973: Heat shock response transcriptional regulator HrcA, HrcA family	* Beutenbergia cavernae DSM 12333 Site: position = -47 score = 6.40594 sequence = TTGGCACTCGGCCCGGGTGAGTGCTGG Gene: Bcav_1748: Heat shock response transcriptional regulator HrcA, HrcA family	* Brachybacterium faecium DSM 4810 Site: position = -98 score = 5.98638 sequence = TTGGCACCTGGCACGGCAGAGTGCCAG Gene: Bfae_17300: Heat shock response transcriptional regulator HrcA, HrcA family	Brevibacterium linens BL2 Gene: BlinB01000188: Heat shock response transcriptional regulator HrcA, HrcA family	* Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -39 score = 5.86703 sequence = TTGGCAGTCAGAACCGACGAGTGCCAG Gene: CMM_1564: Heat shock response transcriptional regulator HrcA, HrcA family	* Janibacter sp. HTCC2649 Site: position = -48 score = 6.24417 sequence = TTGGCACTCACCAAGCATGAGTGCCAG Gene: JNB_05025: Heat shock response transcriptional regulator HrcA, HrcA family	* Jonesia denitrificans DSM 20603 Site: position = -50 score = 6.62301 sequence = TTGGCACTCGGCAGTGGGGAGTGCCAA Gene: Jden_1550: Heat shock response transcriptional regulator HrcA, HrcA family	* Kocuria rhizophila DC2201 Site: position = -90 score = 6.08158 sequence = TTAGCACTGTGCGCGGATGAGTGCCAA Gene: KRH_13010: Heat shock response transcriptional regulator HrcA, HrcA family	* Kytococcus sedentarius DSM 20547 Site: position = -75 score = 5.87878 sequence = CTGGCACTTGACGTCCCCGAGTGCCAG Gene: Ksed_11690: Heat shock response transcriptional regulator HrcA, HrcA family	* Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -49 score = 6.48651 sequence = TTGGCACTCAGGATCAGCGAGTGCTAA Gene: Lxx14650: Heat shock response transcriptional regulator HrcA, HrcA family	* Renibacterium salmoninarum ATCC 33209 Site: position = -233 score = 6.53907 sequence = TTAGCACTTGGGCAAGCCGAGTGCTAA Gene: RSal33209_1927: Heat shock response transcriptional regulator HrcA, HrcA family	Tropheryma whipplei str. Twist	Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ	Arthrobacter sp. FB24 Gene: Arth_2235: Chaperone protein DnaJ	Arthrobacter aurescens TC1 Gene: AAur_2234: Chaperone protein DnaJ	Arthrobacter chlorophenolicus A6 Gene: Achl_1972: Chaperone protein DnaJ	Beutenbergia cavernae DSM 12333 Gene: Bcav_1749: Chaperone protein DnaJ	Brachybacterium faecium DSM 4810 Gene: Bfae_17290: Chaperone protein DnaJ	Brevibacterium linens BL2 Gene: BlinB01000187: Chaperone protein DnaJ	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_1565: Chaperone protein DnaJ	Janibacter sp. HTCC2649 Gene: JNB_05020: Chaperone protein DnaJ	Jonesia denitrificans DSM 20603 Gene: Jden_1549: Chaperone protein DnaJ	Kocuria rhizophila DC2201 Gene: KRH_13000: Chaperone protein DnaJ	Kytococcus sedentarius DSM 20547 Gene: Ksed_11700: Chaperone protein DnaJ	Leifsonia xyli subsp. xyli str. CTCB07 Gene: Lxx14640: Chaperone protein DnaJ	Renibacterium salmoninarum ATCC 33209 Gene: RSal33209_1926: Chaperone protein DnaJ	Tropheryma whipplei str. Twist	Chaperone protein DnaJ
rsmE	Arthrobacter sp. FB24 Gene: Arth_2234: 16S ribosomal RNA methyltransferase	Arthrobacter aurescens TC1 Gene: AAur_2233: 16S ribosomal RNA methyltransferase	Arthrobacter chlorophenolicus A6 Gene: Achl_1971: 16S ribosomal RNA methyltransferase	Beutenbergia cavernae DSM 12333	Brachybacterium faecium DSM 4810 Gene: Bfae_17280: 16S ribosomal RNA methyltransferase	Brevibacterium linens BL2 Gene: BlinB01000186: 16S ribosomal RNA methyltransferase	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_1566: 16S ribosomal RNA methyltransferase	Janibacter sp. HTCC2649 Gene: JNB_05015: 16S ribosomal RNA methyltransferase	Jonesia denitrificans DSM 20603 Gene: Jden_1548: 16S ribosomal RNA methyltransferase	Kocuria rhizophila DC2201 Gene: KRH_12990: 16S ribosomal RNA methyltransferase	Kytococcus sedentarius DSM 20547 Gene: Ksed_11710: 16S ribosomal RNA methyltransferase	Leifsonia xyli subsp. xyli str. CTCB07 Gene: Lxx14630: 16S ribosomal RNA methyltransferase	Renibacterium salmoninarum ATCC 33209 Gene: RSal33209_1925: 16S ribosomal RNA methyltransferase	Tropheryma whipplei str. Twist	16S ribosomal RNA methyltransferase
CRON 4.
groL2	* Arthrobacter sp. FB24 Site: position = -244 score = 6.66381 sequence = CTTGCACTCTCCCCGGGGGAGTGCTAA Site: position = -209 score = 6.31988 sequence = TTAGCACTCCCACGGACTGACTGCTAA Gene: Arth_0779: Heat shock protein 60 family chaperone GroEL	* Arthrobacter aurescens TC1 Site: position = -245 score = 6.63936 sequence = CTTGCACTCTCCCCGGTCGAGTGCTAA Site: position = -210 score = 5.96981 sequence = TTAGCACTCCTATGGTTCGACTGCTAA Gene: AAur_1001: Heat shock protein 60 family chaperone GroEL	* Arthrobacter chlorophenolicus A6 Site: position = -204 score = 6.34222 sequence = TTAGCACTCTGACGTACCGACTGCTAA Site: position = -239 score = 6.54296 sequence = CTTGCACTCTCACCGGGGGAGTGCTAA Gene: Achl_0894: Heat shock protein 60 family chaperone GroEL	* Beutenbergia cavernae DSM 12333 Site: position = -177 score = 6.47859 sequence = CTTGCACTCGCAGGAGGAGAGTGCCAA Site: position = -143 score = 6.35018 sequence = TTAGCACTCTCACCACGAGAGTGACAA Gene: Bcav_0821: Heat shock protein 60 family chaperone GroEL	* Brachybacterium faecium DSM 4810 Site: position = -246 score = 6.27048 sequence = TTAGCACTCTCCGCCGTCGAGTGCTTA Site: position = -212 score = 5.5793 sequence = CTGGCACTCGTGGATCGAGAGTGACAG Gene: Bfae_07610: Heat shock protein 60 family chaperone GroEL	* Brevibacterium linens BL2 Site: position = -184 score = 6.78526 sequence = TTTGCACTCGCATGGGGAGAGTGCTAA Gene: BlinB01000562: Heat shock protein 60 family chaperone GroEL	* Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -71 score = 6.29897 sequence = CTGGCACTCCCTCACGGGGAGTGCTAG Site: position = -106 score = 6.29597 sequence = CTTGCACTCCCGTAGGGCGAGTGCCAG Gene: CMM_2478: Heat shock protein 60 family chaperone GroEL	* Janibacter sp. HTCC2649 Site: position = -155 score = 6.35096 sequence = TTGGCACTCTCCTTAAAGGAGTGCCAA Site: position = -189 score = 6.5077 sequence = TTTGCACTCTCCACCCGAGAGTGCCAA Gene: JNB_16609: Heat shock protein 60 family chaperone GroEL	* Jonesia denitrificans DSM 20603 Site: position = -180 score = 6.47072 sequence = CTTGCACTCTCCATGCGAGAGTGCCAA Site: position = -146 score = 6.40248 sequence = TTGGCACTCTCGCATGGAGAGTGATAA Gene: Jden_2055: Heat shock protein 60 family chaperone GroEL	* Kocuria rhizophila DC2201 Site: position = -176 score = 6.16191 sequence = TTAGCACTCAGTCGAGTGGACTGCTAA Gene: KRH_18370: Heat shock protein 60 family chaperone GroEL	* Kytococcus sedentarius DSM 20547 Site: position = -217 score = 6.07478 sequence = TTGGCACTCGGCGGCTCCGAGTGACAG Gene: Ksed_21770: Heat shock protein 60 family chaperone GroEL	* Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -70 score = 6.63486 sequence = TTAGCACTCCGCCTTACCGAGTGCTAA Site: position = -104 score = 5.91792 sequence = CTTGCACTCCACCGCGACGAGTGCCAG Gene: Lxx18010: Heat shock protein 60 family chaperone GroEL	* Renibacterium salmoninarum ATCC 33209 Site: position = -206 score = 6.28506 sequence = CTTGCACTCTCACCCTTCGAGTGCTAA Site: position = -171 score = 6.46146 sequence = TTAGCACTCTCCCGTTCTGACTGCTAA Gene: RSal33209_0482: Heat shock protein 60 family chaperone GroEL	Tropheryma whipplei str. Twist Gene: TW441: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL
CRON 5.
groS	* Arthrobacter sp. FB24 Site: position = -185 score = 6.75516 sequence = CTGGCACTCGCCTTGACCGAGTGCTAA Site: position = -138 score = 6.75128 sequence = TTAGCACTCTCCCTAGGAGGGTGCTAA Gene: Arth_2887: Heat shock protein 60 family co-chaperone GroES	* Arthrobacter aurescens TC1 Site: position = -122 score = 6.72155 sequence = TTAGCACTCTCCCCCGGAGGGTGCTAA Site: position = -167 score = 6.64992 sequence = CTGGCACTCACCTTGACCGAGTGCTAA Gene: AAur_2875: Heat shock protein 60 family co-chaperone GroES	* Arthrobacter chlorophenolicus A6 Site: position = -136 score = 6.75536 sequence = TTAGCACTCTCCCGAGGAGGGTGCTAA Site: position = -182 score = 6.75516 sequence = CTGGCACTCGCCTTGACCGAGTGCTAA Gene: Achl_2595: Heat shock protein 60 family co-chaperone GroES	* Beutenbergia cavernae DSM 12333 Site: position = -180 score = 6.90065 sequence = TTGGCACTCGCCTTGACCGAGTGCTAA Gene: Bcav_3058: Heat shock protein 60 family co-chaperone GroES	* Brachybacterium faecium DSM 4810 Site: position = -132 score = 6.10539 sequence = TTGGCAGTCGACGGCCGAGAGTGCCAG Site: position = -182 score = 6.33062 sequence = TTAGCACTCGTGTTGCGTGAGTGCCAG Gene: Bfae_08630: Heat shock protein 60 family co-chaperone GroES	* Brevibacterium linens BL2 Site: position = -182 score = 6.56878 sequence = TTGGCACTCGAGTTGACCGAGTGCTAA Site: position = -137 score = 6.05631 sequence = TTAGCACTAGCACTCAGTGAGTGCCAG Gene: BlinB01001687: Heat shock protein 60 family co-chaperone GroES	* Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -65 score = 6.38642 sequence = CTGGCACTCTCCTCGGGAGATTGCCAA Site: position = -112 score = 6.48522 sequence = TTGGCACTCGCGTTGCGCGAGTGCAAG Gene: CMM_2568: Heat shock protein 60 family co-chaperone GroES	* Janibacter sp. HTCC2649 Site: position = -137 score = 6.78376 sequence = TTGGCACTCGCCCTGTGTGAGTGCCAG Site: position = -185 score = 6.56878 sequence = TTGGCACTCGAGTTGACCGAGTGCTAA Gene: JNB_17483: Heat shock protein 60 family co-chaperone GroES	* Jonesia denitrificans DSM 20603 Site: position = -146 score = 6.90065 sequence = TTGGCACTCGCCTTGACCGAGTGCTAA Gene: Jden_0635: Heat shock protein 60 family co-chaperone GroES	* Kocuria rhizophila DC2201 Site: position = -158 score = 6.83007 sequence = TTAGCACTCTCCCAGGGAGGGTGCTAA Gene: KRH_06750: Heat shock protein 60 family co-chaperone GroES	* Kytococcus sedentarius DSM 20547 Site: position = -183 score = 6.22922 sequence = CTGGCACTCGAGTTGACCGAGTGCCAG Site: position = -136 score = 6.0645 sequence = TTGGCACTCAGCGTCGTCGGGTGCCAG Gene: Ksed_07560: Heat shock protein 60 family co-chaperone GroES	* Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -59 score = 5.968 sequence = TTAGCACTCTCATCATGAGGTTGCTAA Site: position = -106 score = 5.98626 sequence = TTGGCACTTACGTTGCGTGACTGCTAA Gene: Lxx19880: Heat shock protein 60 family co-chaperone GroES	* Renibacterium salmoninarum ATCC 33209 Site: position = -177 score = 6.79542 sequence = TTGGCACTCACCTTGACCGAGTGCTAA Site: position = -130 score = 6.386 sequence = TTAGCACTCTCGTACTGAGGGTGCTAA Gene: RSal33209_1769: Heat shock protein 60 family co-chaperone GroES	Tropheryma whipplei str. Twist Gene: TW074: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Arthrobacter sp. FB24 Gene: Arth_2886: Heat shock protein 60 family chaperone GroEL	Arthrobacter aurescens TC1 Gene: AAur_2874: Heat shock protein 60 family chaperone GroEL	Arthrobacter chlorophenolicus A6 Gene: Achl_2594: Heat shock protein 60 family chaperone GroEL	Beutenbergia cavernae DSM 12333	Brachybacterium faecium DSM 4810 Gene: Bfae_08640: Heat shock protein 60 family chaperone GroEL	Brevibacterium linens BL2 Gene: BlinB01001686: Heat shock protein 60 family chaperone GroEL	Clavibacter michiganensis subsp. michiganensis NCPPB 382	Janibacter sp. HTCC2649 Gene: JNB_17488: Heat shock protein 60 family chaperone GroEL	Jonesia denitrificans DSM 20603	Kocuria rhizophila DC2201 Gene: KRH_06760: Heat shock protein 60 family chaperone GroEL	Kytococcus sedentarius DSM 20547 Gene: Ksed_07570: Heat shock protein 60 family chaperone GroEL	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209 Gene: RSal33209_1768: Heat shock protein 60 family chaperone GroEL	Tropheryma whipplei str. Twist	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD