Regulon of HrcA in Arthrobacter sp. FB24

Properties
Regulator type:	Transcription factor
TF locus tag:	Arth_2236
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -185 Score: 6.8 Sequence: CTGGCACTCGCCTTGACCGAGTGCTAA Position: -138 Score: 6.8 Sequence: TTAGCACTCTCCCTAGGAGGGTGCTAA Locus tag: Arth_2887 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Arth_2886 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Arth_2887	groS	Heat shock protein 60 family co-chaperone GroES
	Arth_2886	groL	Heat shock protein 60 family chaperone GroEL
Position: -95 Score: 6.3 Sequence: TTAGCACTTAGACATGTCGAGTGCTAA Locus tag: Arth_2236 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Arth_2235 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Arth_2234 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Arth_2236	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Arth_2235	dnaJ	Chaperone protein DnaJ
	Arth_2234	rsmE	16S ribosomal RNA methyltransferase
Position: -244 Score: 6.7 Sequence: CTTGCACTCTCCCCGGGGGAGTGCTAA Position: -209 Score: 6.3 Sequence: TTAGCACTCCCACGGACTGACTGCTAA Locus tag: Arth_0779 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Arth_0779	groL2	Heat shock protein 60 family chaperone GroEL
Position: -112 Score: 6.4 Sequence: TTAGCACTCAGGCCCTGCGACTGCTAA Locus tag: Arth_2866 Name: COG2331 Funciton: Conserved hypothetical protein
	Arth_2866	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD