Regulon of HrcA in Beutenbergia cavernae DSM 12333

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcav_1748
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 6.5 Sequence: CTTGCACTCGCAGGAGGAGAGTGCCAA Position: -143 Score: 6.4 Sequence: TTAGCACTCTCACCACGAGAGTGACAA Locus tag: Bcav_0821 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Bcav_0821	groL2	Heat shock protein 60 family chaperone GroEL
Position: -47 Score: 6.4 Sequence: TTGGCACTCGGCCCGGGTGAGTGCTGG Locus tag: Bcav_1748 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Bcav_1749 Name: dnaJ Funciton: Chaperone protein DnaJ
	Bcav_1748	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Bcav_1749	dnaJ	Chaperone protein DnaJ
Position: -64 Score: 5.9 Sequence: TTGGCACTCGGTAGTGACAAGTGCTAG Locus tag: Bcav_0902 Name: COG2331 Funciton: Conserved hypothetical protein
	Bcav_0902	COG2331	Conserved hypothetical protein
Position: -180 Score: 6.9 Sequence: TTGGCACTCGCCTTGACCGAGTGCTAA Locus tag: Bcav_3058 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	Bcav_3058	groS	Heat shock protein 60 family co-chaperone GroES

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD