Regulon of HrcA in Jonesia denitrificans DSM 20603

Properties
Regulator type:	Transcription factor
TF locus tag:	Jden_1550
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -180 Score: 6.5 Sequence: CTTGCACTCTCCATGCGAGAGTGCCAA Position: -146 Score: 6.4 Sequence: TTGGCACTCTCGCATGGAGAGTGATAA Locus tag: Jden_2055 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Jden_2055	groL2	Heat shock protein 60 family chaperone GroEL
Position: -77 Score: 5.9 Sequence: TTAGCACTCAGAAGATGAGAGTGCTGG Locus tag: Jden_1970 Name: COG2331 Funciton: Conserved hypothetical protein
	Jden_1970	COG2331	Conserved hypothetical protein
Position: -50 Score: 6.6 Sequence: TTGGCACTCGGCAGTGGGGAGTGCCAA Locus tag: Jden_1550 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Jden_1549 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Jden_1548 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Jden_1550	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Jden_1549	dnaJ	Chaperone protein DnaJ
	Jden_1548	rsmE	16S ribosomal RNA methyltransferase
Position: -146 Score: 6.9 Sequence: TTGGCACTCGCCTTGACCGAGTGCTAA Locus tag: Jden_0635 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	Jden_0635	groS	Heat shock protein 60 family co-chaperone GroES

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD