Regulon of HrcA in Brevibacterium linens BL2

Properties
Regulator type:	Transcription factor
TF locus tag:	BlinB01000188
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -182 Score: 6.6 Sequence: TTGGCACTCGAGTTGACCGAGTGCTAA Position: -137 Score: 6.1 Sequence: TTAGCACTAGCACTCAGTGAGTGCCAG Locus tag: BlinB01001687 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: BlinB01001686 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BlinB01001687	groS	Heat shock protein 60 family co-chaperone GroES
	BlinB01001686	groL	Heat shock protein 60 family chaperone GroEL
Position: -184 Score: 6.8 Sequence: TTTGCACTCGCATGGGGAGAGTGCTAA Locus tag: BlinB01000562 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	BlinB01000562	groL2	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD