Regulon of HrcA in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_17300
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -246 Score: 6.3 Sequence: TTAGCACTCTCCGCCGTCGAGTGCTTA Position: -212 Score: 5.6 Sequence: CTGGCACTCGTGGATCGAGAGTGACAG Locus tag: Bfae_07610 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Bfae_07610	groL2	Heat shock protein 60 family chaperone GroEL
Position: -182 Score: 6.3 Sequence: TTAGCACTCGTGTTGCGTGAGTGCCAG Position: -132 Score: 6.1 Sequence: TTGGCAGTCGACGGCCGAGAGTGCCAG Locus tag: Bfae_08630 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Bfae_08640 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Bfae_08630	groS	Heat shock protein 60 family co-chaperone GroES
	Bfae_08640	groL	Heat shock protein 60 family chaperone GroEL
Position: -98 Score: 6 Sequence: TTGGCACCTGGCACGGCAGAGTGCCAG Locus tag: Bfae_17300 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Bfae_17290 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Bfae_17280 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Bfae_17300	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Bfae_17290	dnaJ	Chaperone protein DnaJ
	Bfae_17280	rsmE	16S ribosomal RNA methyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD