Regulon of HrcA in Kytococcus sedentarius DSM 20547

Properties
Regulator type:	Transcription factor
TF locus tag:	Ksed_11690
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 6.1 Sequence: TTGGCACTCGGCGGCTCCGAGTGACAG Locus tag: Ksed_21770 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Ksed_21770	groL2	Heat shock protein 60 family chaperone GroEL
Position: -183 Score: 6.2 Sequence: CTGGCACTCGAGTTGACCGAGTGCCAG Position: -136 Score: 6.1 Sequence: TTGGCACTCAGCGTCGTCGGGTGCCAG Locus tag: Ksed_07560 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Ksed_07570 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Ksed_07560	groS	Heat shock protein 60 family co-chaperone GroES
	Ksed_07570	groL	Heat shock protein 60 family chaperone GroEL
Position: -75 Score: 5.9 Sequence: CTGGCACTTGACGTCCCCGAGTGCCAG Locus tag: Ksed_11690 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Ksed_11700 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Ksed_11710 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Ksed_11690	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Ksed_11700	dnaJ	Chaperone protein DnaJ
	Ksed_11710	rsmE	16S ribosomal RNA methyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD