Regulon of HrcA in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type:	Transcription factor
TF locus tag:	RSal33209_1927
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Micrococcineae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 6.8 Sequence: TTGGCACTCACCTTGACCGAGTGCTAA Position: -130 Score: 6.4 Sequence: TTAGCACTCTCGTACTGAGGGTGCTAA Locus tag: RSal33209_1769 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RSal33209_1768 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RSal33209_1769	groS	Heat shock protein 60 family co-chaperone GroES
	RSal33209_1768	groL	Heat shock protein 60 family chaperone GroEL
Position: -233 Score: 6.5 Sequence: TTAGCACTTGGGCAAGCCGAGTGCTAA Locus tag: RSal33209_1927 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: RSal33209_1926 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: RSal33209_1925 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	RSal33209_1927	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	RSal33209_1926	dnaJ	Chaperone protein DnaJ
	RSal33209_1925	rsmE	16S ribosomal RNA methyltransferase
Position: -206 Score: 6.3 Sequence: CTTGCACTCTCACCCTTCGAGTGCTAA Position: -171 Score: 6.5 Sequence: TTAGCACTCTCCCGTTCTGACTGCTAA Locus tag: RSal33209_0482 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	RSal33209_0482	groL2	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD