Regulog SmoR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By effector - Sorbitol
- By pathway - Sorbitol utilization
- By pathway - Mannitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | 7 | 2 |
| Loktanella vestfoldensis SKA53 | 2 | 2 |
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | 9 | 2 |
| Oceanicola granulosus HTCC2516 | 2 | 2 |
| Paracoccus denitrificans PD1222 | 12 | 3 |
| Rhodobacter sphaeroides 2.4.1 | ||
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | 7 | 2 |
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 | 7 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| smoR |
|
*
Jannaschia sp. CCS1 Site: position = -85 score = 5.69617 sequence = ATCTTTACGCGCGAAAAGAT Gene: Jann_2901: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
*
Loktanella vestfoldensis SKA53 Site: position = -77 score = 5.17021 sequence = CTGTTAACGCGCGTAAATTT Gene: SKA53_11074: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
*
Oceanicola batsensis HTCC2597 Site: position = -102 score = 5.12599 sequence = AACTTGTCACGCGTAAAATC Gene: OB2597_06120: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
*
Oceanicola granulosus HTCC2516 Site: position = -103 score = 4.86474 sequence = ATGTTGACGCACGTCAAAAA Gene: OG2516_17895: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
*
Paracoccus denitrificans PD1222 Site: position = -54 score = 4.61299 sequence = GTCTTTACGCGAGACAATAT Gene: Pden_4846: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
|
|
|
|
*
Silicibacter TM1040 Site: position = -93 score = 5.06733 sequence = AAGTTTGCGCCCGCAAAGTT Gene: TM1040_0432: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
*
Sulfitobacter sp. EE-36 Site: position = -89 score = 4.25971 sequence = TATTTACCGCGCGACAAGTA Gene: EE36_14657: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
| CRON 2. | ||||||||||||||||
| smoE |
|
*
Jannaschia sp. CCS1 Site: position = -89 score = 6.40309 sequence = AAATTTACGCGCGTAAAGTT Gene: Jann_2902: Various polyols ABC transporter, substrate-binding protein |
*
Loktanella vestfoldensis SKA53 Site: position = -93 score = 5.27513 sequence = TATTTTACGCGCGTAAAATC Gene: SKA53_11098: Various polyols ABC transporter, substrate-binding protein |
|
*2
Oceanicola batsensis HTCC2597 Site: position = -104 score = 5.54523 sequence = TTCTTTACGCGCGTCAAATT Gene: OB2597_06125: Various polyols ABC transporter, substrate-binding protein Gene: OB2597_06130: Various polyols ABC transporter, substrate-binding protein |
*2
Oceanicola granulosus HTCC2516 Site: position = -41 score = 4.34585 sequence = AACTGAACACGCGTAAAAAC Gene: OG2516_17900: Various polyols ABC transporter, substrate-binding protein Gene: OG2516_12599: Various polyols ABC transporter, substrate-binding protein |
*
Paracoccus denitrificans PD1222 Site: position = -87 score = 5.76722 sequence = AATTTTTCGCGCGTAAAAAT Gene: Pden_4845: Various polyols ABC transporter, substrate-binding protein |
Gene: RSP_0091: Various polyols ABC transporter, substrate-binding protein |
Gene: RB2654_13870: Various polyols ABC transporter, substrate-binding protein |
|
|
|
*
Silicibacter TM1040 Site: position = -89 score = 5.80599 sequence = TTCTTTACGCGCGTAAATTT Gene: TM1040_0431: Various polyols ABC transporter, substrate-binding protein |
|
*
Sulfitobacter sp. EE-36 Site: position = -85 score = 5.76423 sequence = AACTAGACGCGCGTAAAATT Gene: EE36_14652: Various polyols ABC transporter, substrate-binding protein |
Various polyols ABC transporter, substrate-binding protein |
| smoF |
|
Gene: Jann_2903: Various polyols ABC transporter, inner membrane component 1 |
Gene: SKA53_11108: Various polyols ABC transporter, inner membrane component 1 |
|
Gene: OB2597_06135: Various polyols ABC transporter, inner membrane component 1 |
Gene: OG2516_12604: Various polyols ABC transporter, inner membrane component 1 |
Gene: Pden_4844: Various polyols ABC transporter, inner membrane component 1 |
Gene: RSP_0092: Various polyols ABC transporter, inner membrane component 1 |
Gene: RB2654_13865: Various polyols ABC transporter, inner membrane component 1 |
|
|
|
Gene: TM1040_0430: Various polyols ABC transporter, inner membrane component 1 |
|
Gene: EE36_14647: Various polyols ABC transporter, inner membrane component 1 |
Various polyols ABC transporter, inner membrane component 1 |
| smoG |
|
Gene: Jann_2904: ABC sorbitol/mannitol transporter, inner membrane component 2 |
Gene: SKA53_11113: ABC sorbitol/mannitol transporter, inner membrane component 2 |
|
Gene: OB2597_06140: ABC sorbitol/mannitol transporter, inner membrane component 2 |
Gene: OG2516_12609: ABC sorbitol/mannitol transporter, inner membrane component 2 |
Gene: Pden_4843: ABC sorbitol/mannitol transporter, inner membrane component 2 |
Gene: RSP_0093: ABC sorbitol/mannitol transporter, inner membrane component 2 |
Gene: RB2654_13860: ABC sorbitol/mannitol transporter, inner membrane component 2 |
|
|
|
Gene: TM1040_0429: ABC sorbitol/mannitol transporter, inner membrane component 2 |
|
Gene: EE36_14642: ABC sorbitol/mannitol transporter, inner membrane component 2 |
ABC sorbitol/mannitol transporter, inner membrane component 2 |
| smoK |
|
Gene: Jann_2905: Various polyols ABC transporter, ATP-binding component |
Gene: SKA53_11118: Various polyols ABC transporter, ATP-binding component |
|
Gene: OB2597_06145: Various polyols ABC transporter, ATP-binding component |
Gene: OG2516_12614: Various polyols ABC transporter, ATP-binding component |
Gene: Pden_4842: Various polyols ABC transporter, ATP-binding component |
Gene: RSP_0094: Various polyols ABC transporter, ATP-binding component |
Gene: RB2654_13855: Various polyols ABC transporter, ATP-binding component |
|
|
|
Gene: TM1040_0428: Various polyols ABC transporter, ATP-binding component |
|
Gene: EE36_14637: Various polyols ABC transporter, ATP-binding component |
Various polyols ABC transporter, ATP-binding component |
| smoS |
|
Gene: Jann_2906: Sorbitol dehydrogenase (EC 1.1.1.14) |
Gene: SKA53_11123: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
Gene: OB2597_06150: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
Gene: Pden_4841: Sorbitol dehydrogenase (EC 1.1.1.14) |
Gene: RSP_0095: Sorbitol dehydrogenase (EC 1.1.1.14) |
Gene: RB2654_13850: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
|
|
Gene: TM1040_0427: Sorbitol dehydrogenase (EC 1.1.1.14) |
|
|
Sorbitol dehydrogenase (EC 1.1.1.14) |
| mtlK |
|
Gene: Jann_2907: Mannitol dehydrogenase (EC 1.1.1.67) |
Gene: SKA53_11128: Mannitol dehydrogenase (EC 1.1.1.67) |
|
Gene: OB2597_06155: Mannitol dehydrogenase (EC 1.1.1.67) |
Gene: OG2516_12619: Mannitol dehydrogenase (EC 1.1.1.67) |
|
Gene: RSP_0096: Mannitol dehydrogenase (EC 1.1.1.67) |
Gene: RB2654_13845: Mannitol dehydrogenase (EC 1.1.1.67) |
Gene: MED193_08118: Mannitol dehydrogenase (EC 1.1.1.67) |
|
|
Gene: TM1040_0426: Mannitol dehydrogenase (EC 1.1.1.67) |
|
Gene: EE36_14632: Mannitol dehydrogenase (EC 1.1.1.67) |
Mannitol dehydrogenase (EC 1.1.1.67) |
| mtlZ |
|
|
|
|
Gene: OB2597_06160: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
|
|
|
Gene: EE36_14627: Fructokinase (EC 2.7.1.4) |
Fructokinase (EC 2.7.1.4) |
| smoD |
|
|
|
|
|
|
Gene: Pden_4840: Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase |
|
|
|
|
|
|
|
|
Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase |
| CRON 3. | ||||||||||||||||
| Pden_4851 |
|
|
|
|
|
|
*
Paracoccus denitrificans PD1222 Site: position = -122 score = 5.44952 sequence = AATTTGACACGCGTAAAATA Gene: Pden_4851: Putative sugar polyol ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
Putative sugar polyol ABC transporter, substrate-binding component |
| Pden_4850 |
|
|
|
|
|
|
Gene: Pden_4850: Putative sugar polyol ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Putative sugar polyol ABC transporter, ATP-binding protein |
| Pden_4849 |
|
|
|
|
|
|
Gene: Pden_4849: Putative sugar polyol ABC transporter, permease components |
|
|
|
|
|
|
|
|
Putative sugar polyol ABC transporter, permease components |
| scrK |
|
|
|
|
|
|
Gene: Pden_4848: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
|
|
Fructokinase (EC 2.7.1.4) |
| pfkZ |
|
|
|
|
|
|
Gene: Pden_4847: 6-phosphofructokinase (EC 2.7.1.11), PF08013 family |
|
|
|
|
|
|
|
|
6-phosphofructokinase (EC 2.7.1.11), PF08013 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |