Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Pden_4850 gene

Properties
Regulog: SmoR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Sorbitol utilization; Mannitol utilization
Effector: Sorbitol
Phylum: Proteobacteria/Alpha
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -122
Score: 5.44952
Sequence: AATTTGACACGCGTAAAATA
Locus tag: Pden_4851
Name: Pden_4851
Funciton: Putative sugar polyol ABC transporter, substrate-binding component
Locus tag: Pden_4850
Name: Pden_4850
Funciton: Putative sugar polyol ABC transporter, ATP-binding protein
Locus tag: Pden_4849
Name: Pden_4849
Funciton: Putative sugar polyol ABC transporter, permease components
Locus tag: Pden_4848
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
Locus tag: Pden_4847
Name: pfkZ
Funciton: 6-phosphofructokinase (EC 2.7.1.11), PF08013 family
Pden_4851-Pden_4850-Pden_4849-scrK-pfkZ -122 5.4 AATTTGACACGCGTAAAATA Pden_4851