Regulon of SmoR in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2597_06120
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.1 Sequence: AACTTGTCACGCGTAAAATC Locus tag: OB2597_06120 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	OB2597_06120	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family
Position: -104 Score: 5.5 Sequence: TTCTTTACGCGCGTCAAATT Locus tag: OB2597_06125 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: OB2597_06130 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: OB2597_06135 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: OB2597_06140 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: OB2597_06145 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: OB2597_06150 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: OB2597_06155 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) Locus tag: OB2597_06160 Name: mtlZ Funciton: Fructokinase (EC 2.7.1.4)
	OB2597_06125	smoE	Various polyols ABC transporter, substrate-binding protein
	OB2597_06130	smoE	Various polyols ABC transporter, substrate-binding protein
	OB2597_06135	smoF	Various polyols ABC transporter, inner membrane component 1
	OB2597_06140	smoG	ABC sorbitol/mannitol transporter, inner membrane component 2
	OB2597_06145	smoK	Various polyols ABC transporter, ATP-binding component
	OB2597_06150	smoS	Sorbitol dehydrogenase (EC 1.1.1.14)
	OB2597_06155	mtlK	Mannitol dehydrogenase (EC 1.1.1.67)
	OB2597_06160	mtlZ	Fructokinase (EC 2.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD