Regulon of SmoR in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_2901
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 6.4 Sequence: AAATTTACGCGCGTAAAGTT Locus tag: Jann_2902 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: Jann_2903 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: Jann_2904 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: Jann_2905 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: Jann_2906 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: Jann_2907 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
	Jann_2902	smoE	Various polyols ABC transporter, substrate-binding protein
	Jann_2903	smoF	Various polyols ABC transporter, inner membrane component 1
	Jann_2904	smoG	ABC sorbitol/mannitol transporter, inner membrane component 2
	Jann_2905	smoK	Various polyols ABC transporter, ATP-binding component
	Jann_2906	smoS	Sorbitol dehydrogenase (EC 1.1.1.14)
	Jann_2907	mtlK	Mannitol dehydrogenase (EC 1.1.1.67)
Position: -85 Score: 5.7 Sequence: ATCTTTACGCGCGAAAAGAT Locus tag: Jann_2901 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	Jann_2901	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD